G1427923



Basic Information


Item Value
gene id G1427923
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 21489810 ~ 21490033 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1634933
GGCTGACCCCAGGTCAGGGGCTTTAGTCCAGAGTCAGCCATGAAAAAAAAACCCACAGGAGACGTGTGAAAGTCATTTTATAGGTTACTCATTCTGTAACTATTACGAAGTAAAGCAGCCATTGGGCTCAGGTGTTTCCCCCATCTTAGCCACTTCACGTTTATAGTGAATTCAATATGCACCTGCAAACTGATGTGCCCTAAGAGGTTTCTGTTGTGCAGGTC

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1634933 True 224 lncRNA 0.46 1 21489810 21490033
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110493454 NA coding downstream 24712 21463000 ~ 21465098 (-)
LOC110493440 LOC106564549 coding downstream 50323 21429348 ~ 21439487 (-)
LOC110493441 sox10 coding downstream 72380 21411626 ~ 21417430 (-)
LOC110493443 NA coding downstream 80563 21407072 ~ 21409247 (-)
LOC110493446 LOC106589449 coding downstream 104162 21377786 ~ 21385648 (-)
mb mb coding upstream 1201 21491234 ~ 21494421 (-)
LOC110493463 LOC106588978 coding upstream 296133 21786166 ~ 21790195 (-)
trnaa-ugc-129 NA coding upstream 340857 21830890 ~ 21830965 (-)
LOC110493466 LOC103354157 coding upstream 360704 21850737 ~ 21851205 (-)
LOC110495103 LOC106598553 coding upstream 400648 21890681 ~ 21895100 (-)
G1427901 NA non-coding downstream 18767 21470665 ~ 21471043 (-)
G1427902 NA non-coding downstream 23710 21465618 ~ 21466100 (-)
G1427897 LOC106564544 non-coding downstream 29407 21460151 ~ 21460403 (-)
G1427896 triobp non-coding downstream 29866 21459371 ~ 21459944 (-)
G1427904 NA non-coding upstream 8722 21498755 ~ 21499887 (-)
G1427900 NA non-coding upstream 38865 21528898 ~ 21529475 (-)
G1427950 NA non-coding upstream 48633 21538666 ~ 21538872 (-)
G1428165 NA non-coding upstream 146858 21636891 ~ 21638651 (-)
G1428230 LOC106589277 non-coding upstream 273168 21763201 ~ 21768179 (-)
G1427703 NA other downstream 478490 21007541 ~ 21032030 (-)
LOC110511666 LOC106589939 other downstream 702225 20785995 ~ 20787989 (-)
G1427608 NA other downstream 715435 20772526 ~ 20774375 (-)
G1427470 NA other downstream 932918 20553196 ~ 20556892 (-)
G1428161 LOC106564449 other upstream 136644 21626677 ~ 21627280 (-)
G1428291 LOC106588995 other upstream 314298 21804331 ~ 21804660 (-)
G1428740 NA other upstream 849346 22339379 ~ 22340563 (-)
G1429642 NA other upstream 1764289 23254322 ~ 23254592 (-)
G1429643 NA other upstream 1764860 23254893 ~ 23255180 (-)

Expression


G1427923 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G1427923 Expression in each Bioproject

Bar chart with 5 bars.
G1427923 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 8.
End of interactive chart.

Co-expression Network