G1428574



Basic Information


Item Value
gene id G1428574
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 21995142 ~ 21995846 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1635696
GTCCTGGAAAATGTCCTCGTTGCCCTCTAAGAAACTCACCCCTAGGGAGAACACAGCTCAGTGTGTTTAGTCAAATATCTATTAGCCTACATTTAGAGACAACAATTGACTTGAATGGCTACTTTATTTGGTTGAAACCAACATTAGTAGGTTTAAAATATCCGATGTGTCATCCAAGAAAAGTTTACGCACAACCATCCTGATCGAATTCCCGGGAAATCTGCGCTCCAAAAACCGCATCCAGAAGAAGTTAAAGTTGCCATGGAAACTGAAAGCGACCACTGCCACATTTCGTGTGTGCCTCCAGTCCATTTTTTCATTGCGCGAGAACAACTGGTGAACGATATCCCCACCGGCAAAAAGGCAACCGTAGAGGGTTACGTTGGTAAACCACGGAAACTTTTTGACGTGTTTTATGAATGCCTTTCTCATGTTGTCGACATCGGAATACAGAAGTTTGAATAGAATATGACAAATAAAACGAGGTCGATATCAAGCAGTTGATGGATGGGGGTCTTCGCCGTCTTCTGTCTGAAAAGCCCATTTGTTATCATCTCTCACT

Function


NR:

description
mpv17-like protein

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1635696 True 562 lncRNA 0.43 2 21995142 21995846

Neighbor


gene id symbol gene type direction distance location
LOC110511450 NA coding downstream 46346 21946015 ~ 21948796 (-)
LOC118940360 NA coding downstream 71604 21919634 ~ 21923538 (-)
LOC110495103 LOC106598553 coding downstream 100042 21890681 ~ 21895100 (-)
LOC110493466 LOC103354157 coding downstream 143937 21850737 ~ 21851205 (-)
trnaa-ugc-129 NA coding downstream 164177 21830890 ~ 21830965 (-)
LOC110493497 LOC106564611 coding upstream 28887 22024733 ~ 22048032 (-)
LOC110493498 LOC100380663 coding upstream 61034 22056880 ~ 22093664 (-)
LOC110493495 cp063 coding upstream 110537 22106383 ~ 22107823 (-)
LOC110493494 LOC106588920 coding upstream 112988 22108834 ~ 22140496 (-)
LOC110495107 xylt1 coding upstream 248247 22244093 ~ 22359648 (-)
G1428573 NA non-coding downstream 439 21994460 ~ 21994703 (-)
G1428570 NA non-coding downstream 6358 21988070 ~ 21988784 (-)
G1428564 LOC106588948 non-coding downstream 7708 21986101 ~ 21987434 (-)
G1428366 NA non-coding downstream 35030 21958316 ~ 21960112 (-)
G1428301 NA non-coding downstream 87259 21822707 ~ 21907883 (-)
G1428654 NA non-coding upstream 199082 22194928 ~ 22200401 (-)
G1428673 NA non-coding upstream 229100 22224946 ~ 22225500 (-)
G1428675 NA non-coding upstream 230920 22226766 ~ 22227218 (-)
G1428782 NA non-coding upstream 413401 22409247 ~ 22409637 (-)
G1428291 LOC106588995 other downstream 190482 21804331 ~ 21804660 (-)
G1428161 LOC106564449 other downstream 367862 21626677 ~ 21627280 (-)
LOC110493443 NA other downstream 585944 21407072 ~ 21409247 (-)
G1427703 NA other downstream 983822 21007541 ~ 21032030 (-)
LOC110511666 LOC106589939 other downstream 1207557 20785995 ~ 20787989 (-)
G1428740 NA other upstream 343533 22339379 ~ 22340563 (-)
G1429642 NA other upstream 1258476 23254322 ~ 23254592 (-)
G1429643 NA other upstream 1259047 23254893 ~ 23255180 (-)
LOC110493468 cnnm2 other upstream 1356652 23233049 ~ 23353185 (-)
LOC110495111 LOC106564590 other upstream 1408805 23403904 ~ 23410855 (-)

Expression


G1428574 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1428574 Expression in each Bioproject

Bar chart with 13 bars.
G1428574 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 8.
End of interactive chart.

Co-expression Network