G1429176



Basic Information


Item Value
gene id G1429176
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 22758696 ~ 22759497 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1636358
cctgtctgtgcctgaccatgtcagtgtctgtgtctgaccatgtctgtgtctgaccatgtctgtgtctgaccatgtctgtgtctgaccatgtctgtgtctgaccctgtctgtgtctgaccatgtctgtgcctgaccatgtctgtgtctgaccatgtctgtgtctgtgtctgaccatgtctgtgtctgaccatgtctgtgtctgaccatgtctgtgtctgaccctgtctgtgtctgaccatgtctgtgtctgtgtctgaccatgtctgtgtctgtgtctgtgtctgac

Function


NR:

description
PREDICTED: probable carboxypeptidase X1 isoform X1

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1636358 True 286 lncRNA 0.52 2 22758696 22759497

Neighbor


gene id symbol gene type direction distance location
LOC110493485 sec23b coding downstream 164360 22576646 ~ 22594336 (-)
LOC110493486 LOC106564601 coding downstream 186417 22556054 ~ 22572279 (-)
LOC110493489 LOC106564596 coding downstream 238357 22507255 ~ 22520339 (-)
nomo LOC106564596 coding downstream 251608 22482938 ~ 22507088 (-)
LOC110495107 xylt1 coding downstream 399048 22244093 ~ 22359648 (-)
LOC110493477 LOC106588590 coding upstream 301968 23061465 ~ 23065730 (-)
LOC110493478 LOC106588598 coding upstream 306606 23066103 ~ 23074400 (-)
LOC110495105 LOC106588599 coding upstream 326785 23086282 ~ 23094793 (-)
LOC110493472 LOC106588633 coding upstream 342304 23101801 ~ 23123984 (-)
LOC118940679 NA coding upstream 346833 23106330 ~ 23106572 (-)
G1429089 NA non-coding downstream 57546 22700920 ~ 22701150 (-)
G1429086 NA non-coding downstream 60302 22698195 ~ 22698394 (-)
G1429060 NA non-coding downstream 61561 22633164 ~ 22697135 (-)
G1429075 NA non-coding downstream 86714 22671253 ~ 22671982 (-)
G1429061 NA non-coding downstream 123363 22634997 ~ 22635333 (-)
G1429182 NA non-coding upstream 9506 22769003 ~ 22771265 (-)
G1429201 NA non-coding upstream 45752 22805249 ~ 22806643 (-)
G1429203 NA non-coding upstream 50020 22809517 ~ 22809841 (-)
G1429208 NA non-coding upstream 68807 22828304 ~ 22829843 (-)
G1429217 NA non-coding upstream 80171 22839668 ~ 22839870 (-)
G1428740 NA other downstream 418133 22339379 ~ 22340563 (-)
G1428291 LOC106588995 other downstream 954036 21804331 ~ 21804660 (-)
G1428161 LOC106564449 other downstream 1131416 21626677 ~ 21627280 (-)
LOC110493443 NA other downstream 1349498 21407072 ~ 21409247 (-)
G1427703 NA other downstream 1747376 21007541 ~ 21032030 (-)
G1429642 NA other upstream 494825 23254322 ~ 23254592 (-)
G1429643 NA other upstream 495396 23254893 ~ 23255180 (-)
LOC110493468 cnnm2 other upstream 593001 23233049 ~ 23353185 (-)
LOC110495111 LOC106564590 other upstream 645154 23403904 ~ 23410855 (-)
LOC110493531 NA other upstream 1296642 24056129 ~ 24057311 (-)

Expression


G1429176 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G1429176 Expression in each Bioproject

Bar chart with 8 bars.
G1429176 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network