G1429642



Basic Information


Item Value
gene id G1429642
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 23254322 ~ 23254592 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1636887
gacaaagcctattccccctcaggagactgaaaagatgtggcatgggtcctgagatcctcaaaaagttctacagctgcagcattgagagcatcctgaccggttacatcactgcctggtacggcaattgctcggcctccgaccgcaaggcactacagagggtaatgcgtacagcccagtacatcactggggcaaagctgcctgccatccaggacctctacaccaggcggtgtcagaggaaggccctaaaaattgtcaaagaccccaatcaccc

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1636887 True 271 TUCP 0.54 1 23254322 23254592
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110493470 LOC106564629 coding downstream 68565 23178814 ~ 23185757 (-)
LOC110493473 LOC106564630 coding downstream 120842 23125813 ~ 23133480 (-)
LOC110493472 LOC106588633 coding downstream 130338 23101801 ~ 23123984 (-)
LOC118940660 NA coding downstream 133521 23120653 ~ 23120801 (-)
LOC118940679 NA coding downstream 147750 23106330 ~ 23106572 (-)
LOC110495109 as3mt coding upstream 102991 23357583 ~ 23364991 (-)
LOC110495110 LOC106564588 coding upstream 112655 23366232 ~ 23392263 (-)
LOC110493511 LOC106564589 coding upstream 137864 23392456 ~ 23400169 (-)
LOC110495111 LOC106564590 coding upstream 149312 23403904 ~ 23410855 (-)
LOC110493520 LOC106586688 coding upstream 613747 23868339 ~ 23880612 (-)
G1429641 NA non-coding downstream 201 23253809 ~ 23254121 (-)
G1429638 NA non-coding downstream 6027 23248038 ~ 23248295 (-)
G1429603 NA non-coding downstream 8134 23169746 ~ 23246188 (-)
G1429596 NA non-coding downstream 23814 23222969 ~ 23230508 (-)
G1429597 NA non-coding downstream 33000 23217448 ~ 23221322 (-)
G1429645 NA non-coding upstream 3063 23257655 ~ 23257949 (-)
G1429646 NA non-coding upstream 4709 23259301 ~ 23259522 (-)
G1429649 NA non-coding upstream 8856 23263448 ~ 23309397 (-)
G1429669 NA non-coding upstream 74511 23329103 ~ 23329338 (-)
G1429670 NA non-coding upstream 75272 23329864 ~ 23330151 (-)
G1428740 NA other downstream 913759 22339379 ~ 22340563 (-)
G1428291 LOC106588995 other downstream 1449662 21804331 ~ 21804660 (-)
G1428161 LOC106564449 other downstream 1627042 21626677 ~ 21627280 (-)
LOC110493443 NA other downstream 1845124 21407072 ~ 21409247 (-)
G1427703 NA other downstream 2243002 21007541 ~ 21032030 (-)
G1429643 NA other upstream 301 23254893 ~ 23255180 (-)
LOC110493468 cnnm2 other upstream 97906 23233049 ~ 23353185 (-)
LOC110493531 NA other upstream 801547 24056129 ~ 24057311 (-)
G1430651 NA other upstream 951812 24206404 ~ 24207771 (-)

Expression


G1429642 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G1429642 Expression in each Bioproject

Bar chart with 20 bars.
G1429642 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network