G1429643



Basic Information


Item Value
gene id G1429643
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 23254893 ~ 23255180 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1636888
ctggacaaaaggaacacctatgtaagaatgctattcattgaatgcagctcagcgttcaacaccatagtaccctcaaagctcatcaataagctaaggaccctgggactaaacacctccctctgcaactggatcctggacttcctgatgggccggccccaggtggtgagggtaggtggcaacacatctgccacgctgatcctcaacactggagctccccagggatgcgtgctcagttccctcctgtactccttgttcacccacgactgcatggccaggcacgacaccaac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1636888 True 288 TUCP 0.54 1 23254893 23255180

Neighbor


gene id symbol gene type direction distance location
LOC110493470 LOC106564629 coding downstream 69136 23178814 ~ 23185757 (-)
LOC110493473 LOC106564630 coding downstream 121413 23125813 ~ 23133480 (-)
LOC110493472 LOC106588633 coding downstream 130909 23101801 ~ 23123984 (-)
LOC110495109 as3mt coding upstream 102403 23357583 ~ 23364991 (-)
LOC110495110 LOC106564588 coding upstream 112067 23366232 ~ 23392263 (-)
LOC110493511 LOC106564589 coding upstream 137276 23392456 ~ 23400169 (-)
LOC110495111 LOC106564590 coding upstream 148724 23403904 ~ 23410855 (-)
LOC110493520 LOC106586688 coding upstream 613159 23868339 ~ 23880612 (-)
G1429641 NA non-coding downstream 772 23253809 ~ 23254121 (-)
G1429638 NA non-coding downstream 6598 23248038 ~ 23248295 (-)
G1429603 NA non-coding downstream 8705 23169746 ~ 23246188 (-)
G1429645 NA non-coding upstream 2475 23257655 ~ 23257949 (-)
G1429646 NA non-coding upstream 4121 23259301 ~ 23259522 (-)
G1429649 NA non-coding upstream 8268 23263448 ~ 23309397 (-)
G1429669 NA non-coding upstream 73923 23329103 ~ 23329338 (-)
G1429670 NA non-coding upstream 74684 23329864 ~ 23330151 (-)
G1429642 NA other downstream 301 23254322 ~ 23254592 (-)
G1428740 NA other downstream 914330 22339379 ~ 22340563 (-)
G1428291 LOC106588995 other downstream 1450233 21804331 ~ 21804660 (-)
G1428161 LOC106564449 other downstream 1627613 21626677 ~ 21627280 (-)
LOC110493443 NA other downstream 1845695 21407072 ~ 21409247 (-)
LOC110493468 cnnm2 other upstream 97318 23233049 ~ 23353185 (-)
LOC110493531 NA other upstream 800959 24056129 ~ 24057311 (-)
G1430651 NA other upstream 951224 24206404 ~ 24207771 (-)
G1431278 NA other upstream 1233315 24488495 ~ 24489228 (-)

Expression


G1429643 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G1429643 Expression in each Bioproject

Bar chart with 18 bars.
G1429643 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network