G1429776


Basic Information

Item Value
gene id G1429776
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 23447060 ~ 23447730 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU1637051
acggtgtccccagtgcgggtgcacagcccggtgcggtacattccagctccgcgtatcggccgggctagagtgggcatcgagccaagtgccatgaagccggctctacgcatctggtctccagtgcgtctccttgggccggcttacatggcaccagccttgcgcatggtgtccccggttcgcctgcatagcccagtgcgggctattccacctcgccgcactggcagggcgaccgggaccattcaaccgggtaaggttgggcaggctcggtgctcaagagctccagtgcgcctgcacggcccggtctatccgtcaccacctccacaccccagccctccggtggcagctccccgtaccaggctgtctctccggcccatccgtccagagccttcctcctctccagcgctgccggagcctcccgcctgtccggcgcctctgccggagcctcccgcctgtccggcgcctctgccggagcctcccgcctgtccggcgcctctgccggagcttcccgtctgcccggcgcctctgccagagcttcgcgtctgcccggcgccatcggagcttcccgtctgcccagcgccgtcagcgccgcccgtctgcccagcgccgccagtgccgcccgtctgcccagcgccgccagtgccgcccgtctgcccagcgccgccagtgccgcc

Function

NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU1637051 True 671 TUCP 0.72 1 23447060 23447730
Loading

Neighbor

gene id symbol gene type direction distance location
LOC110493512 dpcd coding upstream 44262 23400228 ~ 23402798 (+)
LOC110493471 LOC106588647 coding upstream 225727 23189080 ~ 23221333 (+)
LOC110493475 NA coding upstream 321647 23124029 ~ 23125426 (+)
LOC110493474 LOC106588617 coding upstream 345306 23095456 ~ 23101754 (+)
LOC110493476 LOC106564617 coding upstream 361804 23081478 ~ 23085256 (+)
LOC110493513 LOC106564616 coding downstream 24039 23471769 ~ 23500002 (+)
LOC110493514 lbx1 coding downstream 103899 23551629 ~ 23554314 (+)
LOC110493516 LOC106588720 coding downstream 118012 23565742 ~ 23571693 (+)
LOC110493515 LOC100286439 coding downstream 124234 23571964 ~ 23581274 (+)
rims1b LOC106586590 coding downstream 140488 23588218 ~ 23695383 (+)
G1429752 NA non-coding upstream 28310 23418547 ~ 23418750 (+)
G1429707 NA non-coding upstream 71296 23372475 ~ 23375764 (+)
G1429705 NA non-coding upstream 76888 23367258 ~ 23370172 (+)
G1429700 NA non-coding upstream 82722 23364124 ~ 23364338 (+)
G1429465 cnnm2 non-coding upstream 93843 23352526 ~ 23353217 (+)
G1429777 NA non-coding downstream 1657 23449387 ~ 23449854 (+)
G1429790 NA non-coding downstream 26232 23473962 ~ 23474183 (+)
G1429792 NA non-coding downstream 31396 23479126 ~ 23479344 (+)
G1429795 NA non-coding downstream 38723 23486453 ~ 23486659 (+)
G1429775 NA other upstream 83 23446548 ~ 23446977 (+)
LOC110495106 LOC106564608 other upstream 474204 22962952 ~ 22986459 (+)
G1428970 LOC106564586 other upstream 786369 22659808 ~ 22660691 (+)
LOC110493484 LOC106564584 other upstream 850365 22594594 ~ 22633784 (+)
LOC110493519 LOC106564707 other downstream 415295 23701419 ~ 23866193 (+)
G1432630 NA other downstream 2315236 25762966 ~ 25823263 (+)
LOC110493559 LOC106587120 other downstream 3235595 26683052 ~ 26685644 (+)
LOC110493575 NA other downstream 3872247 27313574 ~ 27333248 (+)
LOC118940374 LOC106587354 other downstream 4089465 27534233 ~ 27540054 (+)

Expression

G1429776 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 25.
End of interactive chart.

G1429776 Expression in each Bioproject

Bar chart with 21 bars.
G1429776 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network