G1429790



Basic Information


Item Value
gene id G1429790
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 23473962 ~ 23474183 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1637065
CAAGAAGCCATTGCAAGCCATCAATCAAGTTAGTGTAGTTATCTTGTATGCTGACACAACGATTCTGGTAGTTATTGGTCGTAGTAGCCTACTCTGATTCTGTCCCACTCTGAATAATAGAATAGAGTTTGGCCTTGTAAAAGGGATTTTCTGTCAACTTTACATTTTAGATTAAATTTGTTCAATTGAACTGTCAAGTTTGTCCCTAACCAATTCTAGATG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1637065 True 222 lncRNA 0.36 1 23473962 23474183
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110493512 dpcd coding upstream 71164 23400228 ~ 23402798 (+)
LOC110493471 LOC106588647 coding upstream 252629 23189080 ~ 23221333 (+)
LOC110493475 NA coding upstream 348549 23124029 ~ 23125426 (+)
LOC110493474 LOC106588617 coding upstream 372208 23095456 ~ 23101754 (+)
LOC110493476 LOC106564617 coding upstream 388706 23081478 ~ 23085256 (+)
LOC110493514 lbx1 coding downstream 77446 23551629 ~ 23554314 (+)
LOC110493516 LOC106588720 coding downstream 91559 23565742 ~ 23571693 (+)
LOC110493515 LOC100286439 coding downstream 97781 23571964 ~ 23581274 (+)
rims1b LOC106586590 coding downstream 114035 23588218 ~ 23695383 (+)
LOC110493519 LOC106564707 coding downstream 227236 23701419 ~ 23866193 (+)
G1429777 NA non-coding upstream 24108 23449387 ~ 23449854 (+)
G1429752 NA non-coding upstream 55212 23418547 ~ 23418750 (+)
G1429707 NA non-coding upstream 98198 23372475 ~ 23375764 (+)
G1429705 NA non-coding upstream 103790 23367258 ~ 23370172 (+)
G1429700 NA non-coding upstream 109624 23364124 ~ 23364338 (+)
G1429792 NA non-coding downstream 4943 23479126 ~ 23479344 (+)
G1429795 NA non-coding downstream 12270 23486453 ~ 23486659 (+)
LOC110493513 LOC106564616 non-coding downstream 25035 23471769 ~ 23500002 (+)
G1429764 NA non-coding downstream 25918 23500101 ~ 23500311 (+)
G1429801 NA non-coding downstream 30336 23504519 ~ 23504757 (+)
G1429776 NA other upstream 26232 23447060 ~ 23447730 (+)
G1429775 NA other upstream 26985 23446548 ~ 23446977 (+)
LOC110495106 LOC106564608 other upstream 501106 22962952 ~ 22986459 (+)
G1428970 LOC106564586 other upstream 813271 22659808 ~ 22660691 (+)
G1432630 NA other downstream 2288783 25762966 ~ 25823263 (+)
LOC110493559 LOC106587120 other downstream 3209142 26683052 ~ 26685644 (+)
LOC110493575 NA other downstream 3845794 27313574 ~ 27333248 (+)
LOC118940374 LOC106587354 other downstream 4063012 27534233 ~ 27540054 (+)

Expression


G1429790 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1429790 Expression in each Bioproject

Bar chart with 3 bars.
G1429790 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 30.
End of interactive chart.

Co-expression Network