G1430492



Basic Information


Item Value
gene id G1430492
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 23886501 ~ 23886876 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1637865
acaaatctccgtcccagtctcaggtcttttgcagactccatcaggttcttccagaatggtcctgtatttggctccatccatcttcccatcaattttaaccatcttccctgtccctgctgaagaaaagcaggtccaaaccatgatgctgccaccaccatgtttgacagtggggatggtgtgttcagtgtgatgagctgtgttgcttttacgccaaacataacgttttgcattgttgccaaaaagttccattttggtttcatctgaccagagcaccttcttccacatgtttggtgtgtctccctaaacgacactttttatggatatctttaagaaatggctttcttcttgccactcttccataaaggccagatttgtg

Function


NR:

description
Tc1-like transporase

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1637865 True 376 lncRNA 0.44 1 23886501 23886876

Neighbor


gene id symbol gene type direction distance location
LOC110493524 NA coding downstream 2027 23882571 ~ 23884474 (-)
LOC110493520 LOC106586688 coding downstream 5889 23868339 ~ 23880612 (-)
LOC110495111 LOC106564590 coding downstream 475646 23403904 ~ 23410855 (-)
LOC110493511 LOC106564589 coding downstream 486332 23392456 ~ 23400169 (-)
LOC110495110 LOC106564588 coding downstream 494238 23366232 ~ 23392263 (-)
LOC110493527 LOC106564701 coding upstream 20523 23907399 ~ 23959574 (-)
LOC110493529 LOC106564702 coding upstream 76316 23963192 ~ 24031795 (-)
LOC110493530 dtd1 coding upstream 147476 24034352 ~ 24051965 (-)
LOC110493531 NA coding upstream 169253 24056129 ~ 24057311 (-)
slkb LOC106586757 coding upstream 206438 24093314 ~ 24127921 (-)
G1430491 NA non-coding downstream 192 23885950 ~ 23886309 (-)
G1430490 NA non-coding downstream 645 23885469 ~ 23885856 (-)
G1430486 NA non-coding downstream 18285 23866232 ~ 23868216 (-)
G1430485 NA non-coding downstream 20443 23865701 ~ 23866058 (-)
G1430499 NA non-coding upstream 16735 23903611 ~ 23903841 (-)
G1430511 NA non-coding upstream 40720 23927596 ~ 23927843 (-)
G1430551 NA non-coding upstream 132195 24019071 ~ 24019982 (-)
G1430552 NA non-coding upstream 133261 24020137 ~ 24020372 (-)
LOC110493468 cnnm2 other downstream 533493 23233049 ~ 23353185 (-)
G1429643 NA other downstream 631321 23254893 ~ 23255180 (-)
G1429642 NA other downstream 631909 23254322 ~ 23254592 (-)
G1428740 NA other downstream 1545938 22339379 ~ 22340563 (-)
G1430651 NA other upstream 319528 24206404 ~ 24207771 (-)
G1431278 NA other upstream 601619 24488495 ~ 24489228 (-)
cxcf1b cxcf1b other upstream 1917895 25804771 ~ 25806202 (-)
G1433142 LOC106586974 other upstream 2087506 25974382 ~ 25982561 (-)

Expression


G1430492 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G1430492 Expression in each Bioproject

Bar chart with 18 bars.
G1430492 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network