G1433838


Basic Information

Item Value
gene id G1433838
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 27110741 ~ 27113553 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU1641511
tgactgtgtgtgtgtctgactgtgtgtgtgtgtctgactgtgtgtgtgtgtctgactgtgtgtgtgtgtctgactgtgtgtgtgtgtctgactgtgtgtgtgtgtgtctgactgtgtgtgtgtgtctgactgtgtgtgtgtgtctgactgtgtgtgtgtgtgtctgactgtgtgtgtgtgtgtctgactgtgtgtgtgtgtgtctgactgtgtgtgtgtgtgtctgactgtgtgtgtgtgtgtgtctgactgtgtgtgtgtgtgtctgactgtgtgtgtgtgtgtgtctgactgtgtgtgtgtgtgtgtctgactgtgtgtgtgtgtgtctgactgtgtgtgtgtgtctgactgtgtgtgtgtgtctgactgtgtgtgtgtcttgactgtgtgtgtgtcttgactgtgtgtgtgtcttgactgtgtgtgtgtcttgactgtgtgtgtgtctgactgtgtgtgtgtctgactgtgtgtgtctgactgtgtgtgtgtgtctgactgtgtgtgtgtgtctgactgactgtgtgtgtgtctgactgactgtgtgtgtgtgtgtctgactgtgtgtgtgtctgactgtgtgtgtgtctgactgtgtgtgtgtctgactgtgtgtgtgtctgactgtgtgtgtgtgtctgactgtgtgtgtgtgtgtctgactgtgtgtgtgtgtgtgtctgactgtgtgtgtgtgtgtctgactgactgtgtgtgtgtctgactgactgtgtgtgtgtctgactgactgtgtgtctgactgactgactgtgtgt

Function

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU1641511 True 779 lncRNA 0.50 2 27110741 27113553
Loading

Neighbor

gene id symbol gene type direction distance location
LOC110495152 NA coding upstream 161696 26929368 ~ 26949045 (+)
sept9b LOC106564665 coding upstream 182463 26844294 ~ 26928896 (+)
LOC110493562 LOC106595010 coding upstream 295039 26812439 ~ 26815702 (+)
LOC110493561 LOC106564667 coding upstream 310731 26758441 ~ 26800010 (+)
hn1 hn1 coding upstream 411459 26687598 ~ 26699282 (+)
tefm LOC106564655 coding downstream 159429 27272982 ~ 27276208 (+)
utp6 LOC106564653 coding downstream 182316 27295869 ~ 27308012 (+)
LOC110493575 NA coding downstream 200611 27313574 ~ 27333248 (+)
LOC118940369 NA coding downstream 310899 27424452 ~ 27426672 (+)
LOC110515386 LOC106564710 coding downstream 380067 27493620 ~ 27496323 (+)
G1433835 NA non-coding upstream 2001 27106699 ~ 27108740 (+)
G1433780 NA non-coding upstream 43890 27003338 ~ 27066851 (+)
G1433756 NA non-coding upstream 129982 26968391 ~ 26980759 (+)
G1433846 NA non-coding downstream 42031 27155584 ~ 27159240 (+)
G1433855 NA non-coding downstream 61959 27175512 ~ 27231404 (+)
G1433900 NA non-coding downstream 141332 27254885 ~ 27258392 (+)
G1433902 NA non-coding downstream 147746 27261299 ~ 27261857 (+)
G1433906 LOC106564656 non-coding downstream 151430 27264983 ~ 27287348 (+)
LOC110493559 LOC106587120 other upstream 425100 26683052 ~ 26685644 (+)
G1432630 NA other upstream 1287478 25762966 ~ 25823263 (+)
LOC110493519 LOC106564707 other upstream 3245343 23701419 ~ 23866193 (+)
G1429776 NA other upstream 3663011 23447060 ~ 23447730 (+)
G1429775 NA other upstream 3663764 23446548 ~ 23446977 (+)
LOC118940374 LOC106587354 other downstream 423642 27534233 ~ 27540054 (+)
LOC110493581 LOC106564710 other downstream 429634 27543187 ~ 27547668 (+)
LOC118940376 LOC106564710 other downstream 440163 27549527 ~ 27555427 (+)
LOC110493582 LOC106564710 other downstream 484944 27595643 ~ 27602283 (+)

Expression

G1433838 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G1433838 Expression in each Bioproject

Bar chart with 18 bars.
G1433838 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network