G1433988



Basic Information


Item Value
gene id G1433988
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 27446241 ~ 27451970 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1641688
tctgtcacgtagagtaggccagaaggctaaactggataacctaacctctatcaaaataaaaagatggcggagccgcaaaagttcttctgtgcaaaggtgtttatttacaagtgattccggaacaaaaaacaacagtactgccatcaacgtctaccttatgggacagcttaaaaacaatgctgccccatccacagctcaatccaaaaaaatgccctccttagagactggagagaggctccttttgtagggctagcccctcccctcagaacaattaaccctaattaattaatcaattaacaatacaaacctacattttccatgaactaaacatactaaaggatatacattgcaacacggttttaaacaatatcacaacataacatttacaacattac

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1641688 True 395 lncRNA 0.39 2 27446241 27451970
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118940369 NA coding upstream 19569 27424452 ~ 27426672 (+)
LOC110493575 NA coding upstream 112993 27313574 ~ 27333248 (+)
utp6 LOC106564653 coding upstream 138229 27295869 ~ 27308012 (+)
tefm LOC106564655 coding upstream 170033 27272982 ~ 27276208 (+)
tnrc6c2 LOC106564661 coding upstream 296941 27054451 ~ 27149300 (+)
LOC110515386 LOC106564710 coding downstream 41650 27493620 ~ 27496323 (+)
LOC118940370 LOC106564710 coding downstream 44464 27496434 ~ 27505085 (+)
LOC118940372 LOC106564710 coding downstream 54352 27506322 ~ 27513332 (+)
LOC118940371 LOC106564710 coding downstream 61372 27513342 ~ 27519163 (+)
LOC118940373 LOC106587354 coding downstream 71511 27523481 ~ 27525977 (+)
G1433945 NA non-coding upstream 65955 27379705 ~ 27380286 (+)
G1433904 NA non-coding upstream 154111 27290372 ~ 27292130 (+)
G1433906 LOC106564656 non-coding upstream 158893 27264983 ~ 27287348 (+)
G1433902 NA non-coding upstream 184384 27261299 ~ 27261857 (+)
G1434451 NA non-coding downstream 37790 27489760 ~ 27490153 (+)
G1434457 NA non-coding downstream 44097 27496067 ~ 27504039 (+)
G1434466 NA non-coding downstream 81696 27533666 ~ 27534273 (+)
LOC110493581 LOC106564710 non-coding downstream 91852 27543187 ~ 27547668 (+)
LOC110493559 LOC106587120 other upstream 760600 26683052 ~ 26685644 (+)
G1432630 NA other upstream 1622978 25762966 ~ 25823263 (+)
LOC110493519 LOC106564707 other upstream 3580843 23701419 ~ 23866193 (+)
G1429776 NA other upstream 3998511 23447060 ~ 23447730 (+)
LOC118940374 LOC106587354 other downstream 85225 27534233 ~ 27540054 (+)
LOC118940376 LOC106564710 other downstream 101746 27549527 ~ 27555427 (+)
LOC110493582 LOC106564710 other downstream 146527 27595643 ~ 27602283 (+)
G1434530 NA other downstream 266487 27718457 ~ 27718847 (+)

Expression


G1433988 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G1433988 Expression in each Bioproject

Bar chart with 20 bars.
G1433988 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network