G1434489 (LOC106564710)



Basic Information


Item Value
gene id G1434489
gene name LOC106564710
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 27598819 ~ 27606732 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1642259
GTTCAGGGATGCCTGTGAGAGTGCCCAGGAGGCCGCCAGACGGATCCACCACATGAGGACTGGAAGAGGCAACAACAGCCAGAATGGGAGTTGGCCTGGGTCGTCACAGGGATCAAGCAAATCCAACATGCCAGAGTTGGGAGAACTGGGGTCAGTGAGGAGTCCCAAGGGAAGTGACGTCCATAAAGTCCTTAGCGAGGGGTCCCTCCCTGTCTTTGCCCTGTTTGAGGAG

Function


NR:

description
uncharacterized protein LOC110493582

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1642259 True 232 lncRNA 0.57 2 27598819 27606732
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118940115 LOC106564710 coding upstream 4663 27587727 ~ 27594181 (+)
LOC118940380 LOC106564710 coding upstream 12404 27582169 ~ 27586415 (+)
LOC118940114 LOC106564710 coding upstream 20387 27573153 ~ 27578432 (+)
LOC118940379 LOC106564710 coding upstream 27894 27565030 ~ 27570925 (+)
LOC118940377 LOC106564710 coding upstream 35460 27559072 ~ 27563359 (+)
LOC118940381 LOC106564710 coding downstream 4833 27611565 ~ 27617748 (+)
LOC118940382 NA coding downstream 12505 27619237 ~ 27621203 (+)
LOC118940383 LOC106564710 coding downstream 14490 27621222 ~ 27625453 (+)
LOC118940384 NA coding downstream 20208 27626940 ~ 27628906 (+)
LOC118940386 LOC106564710 coding downstream 22193 27628925 ~ 27633163 (+)
LOC118940376 LOC106564710 non-coding upstream 43417 27549527 ~ 27555427 (+)
LOC110493581 LOC106564710 non-coding upstream 51175 27543187 ~ 27547668 (+)
G1434466 NA non-coding upstream 64546 27533666 ~ 27534273 (+)
G1434499 NA non-coding downstream 18384 27625116 ~ 27633062 (+)
G1434517 NA non-coding downstream 97625 27704357 ~ 27710413 (+)
G1434539 NA non-coding downstream 120458 27727190 ~ 27729270 (+)
G1434695 NA non-coding downstream 200039 27806771 ~ 27807061 (+)
G1434711 NA non-coding downstream 215494 27822226 ~ 27822462 (+)
LOC110493582 LOC106564710 other upstream 27 27595643 ~ 27602283 (+)
LOC118940374 LOC106587354 other upstream 61249 27534233 ~ 27540054 (+)
LOC110493575 NA other upstream 265646 27313574 ~ 27333248 (+)
G1434530 NA other downstream 111725 27718457 ~ 27718847 (+)
G1434906 NA other downstream 589964 28196696 ~ 28197581 (+)
G1435540 NA other downstream 1057622 28664354 ~ 28664979 (+)
LOC110495133 LOC106564943 other downstream 1197085 28803282 ~ 28810516 (+)
LOC110493649 LOC106588056 other downstream 1242190 28848883 ~ 28853257 (+)

Expression


G1434489(LOC106564710) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: -0.5 to 0.5.
End of interactive chart.

Co-expression Network