G1435433



Basic Information


Item Value
gene id G1435433
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 28503697 ~ 28504230 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1643415
gtctcccaggtggcttgtggcaaactttaaacaacactttttatggatatctttaagaaatggctttcttcttgccactcttccataaaggccagatttgtgcaatatacgactgattgttgccctatggacagactctcccacctcagctgtagatctctgcagttcatccagagtgatcatgggcctcttggctgcatctctgatcagtcttctccttgtatgagctgaaagtttagagggacggccaggtcttggtagatttgcagtggtctgatactccttccatttcaatatcatcgcttgcacagtgctccttgggatgtttaaagcttgggaaatctttttgtatccaaatccggctttaaacttcttcacaacagtatctcggacctgcctggtgtgttccttgttcttcatgatgctctctgcgcttttgacgtacctctgagactatcacagtgcaggtgcatttatacggagacttgattacacacaggtggattgtatttatcatcataatcatttaggtca

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1643415 True 534 lncRNA 0.44 1 28503697 28504230

Neighbor


gene id symbol gene type direction distance location
LOC110493625 LOC106569433 coding downstream 106462 28394623 ~ 28397235 (-)
LOC118936556 LOC106569433 coding downstream 113964 28387136 ~ 28389733 (-)
LOC110495156 LOC106564766 coding downstream 134677 28366452 ~ 28369020 (-)
LOC110493621 LOC106564766 coding downstream 174823 28328130 ~ 28328877 (-)
LOC110495126 LOC106564751 coding downstream 216899 28255049 ~ 28286798 (-)
LOC110493627 LOC106564957 coding upstream 51324 28555554 ~ 28560692 (-)
LOC110493630 LOC106564955 coding upstream 106155 28610385 ~ 28622231 (-)
LOC101268960 LOC106564996 coding upstream 120010 28624240 ~ 28626947 (-)
LOC110493634 LOC106564954 coding upstream 132782 28637012 ~ 28645555 (-)
LOC110493635 LOC100194498 coding upstream 146774 28651004 ~ 28670920 (-)
LOC110495129 NA non-coding downstream 4940 28496785 ~ 28521285 (-)
G1435386 NA non-coding downstream 7237 28486078 ~ 28496460 (-)
G1435388 LOC106564959 non-coding downstream 8015 28481275 ~ 28495682 (-)
G1435384 NA non-coding downstream 17121 28474302 ~ 28486576 (-)
G1435383 NA non-coding downstream 36959 28456493 ~ 28466738 (-)
G1435434 NA non-coding upstream 74 28504304 ~ 28504823 (-)
G1435445 NA non-coding upstream 13469 28517699 ~ 28517973 (-)
G1435385 NA non-coding upstream 18510 28522740 ~ 28527066 (-)
G1435458 NA non-coding upstream 36334 28540564 ~ 28540783 (-)
G1435865 NA non-coding upstream 67251 28571481 ~ 28571806 (-)
G1435199 LOC106587683 other downstream 303015 28189019 ~ 28200682 (-)
G1435257 NA other downstream 321136 28181042 ~ 28182561 (-)
LOC110495123 LOC106587585 other downstream 455696 28043251 ~ 28048026 (-)
G1435467 NA other upstream 43043 28547273 ~ 28547556 (-)
G1436694 NA other upstream 1108022 29612252 ~ 29612608 (-)
LOC110495137 LOC106564911 other upstream 1434096 29926378 ~ 29979179 (-)
G1437411 NA other upstream 1546372 30050602 ~ 30114123 (-)
G1437507 NA other upstream 1737220 30241450 ~ 30243706 (-)

Expression


G1435433 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G1435433 Expression in each Bioproject

Bar chart with 19 bars.
G1435433 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network