G1436535



Basic Information


Item Value
gene id G1436535
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 29686215 ~ 29686420 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1644643
cagaaaagcagaacttaatatttggtacagaaaccattgtttgcaattacagagatcatacgtttcctgtagttcttgaccaggtttgcacacactgcagcagggattttggcccactcctgcatacagaccttctccagatcgttcaggttttggggctgtcgctgggcaatacggactttcagctccctccaaatattttctat

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1644643 True 206 lncRNA 0.45 1 29686215 29686420
Loading

Neighbor


gene id symbol gene type direction distance location
trnaa-ugc-130 NA coding upstream 158020 29528122 ~ 29528195 (+)
LOC110493662 LOC106564925 coding upstream 396017 29285360 ~ 29290198 (+)
LOC110493657 LOC106564932 coding upstream 659722 29022435 ~ 29026838 (+)
LOC110493652 LOC106564933 coding upstream 686384 28987773 ~ 28999831 (+)
LOC118940116 LOC106564938 coding upstream 827305 28851739 ~ 28858910 (+)
LOC110493665 LOC106564917 coding downstream 32283 29718703 ~ 29756838 (+)
LOC110495157 LOC106564973 coding downstream 107146 29793566 ~ 29795426 (+)
LOC110493668 LOC105021619 coding downstream 132519 29818939 ~ 29820743 (+)
cygb2 LOC106564914 coding downstream 172217 29858637 ~ 29868058 (+)
LOC118940394 NA coding downstream 185571 29871991 ~ 29880729 (+)
G1436532 NA non-coding upstream 3070 29682529 ~ 29683145 (+)
G1436529 NA non-coding upstream 8751 29677235 ~ 29677464 (+)
G1436528 NA non-coding upstream 20045 29665939 ~ 29666170 (+)
G1436525 NA non-coding upstream 28342 29657658 ~ 29657873 (+)
G1436522 NA non-coding upstream 31404 29654594 ~ 29654811 (+)
G1436542 NA non-coding downstream 9112 29695532 ~ 29695874 (+)
G1436552 NA non-coding downstream 28979 29715399 ~ 29715621 (+)
G1436760 NA non-coding downstream 71313 29757733 ~ 29759708 (+)
G1436803 NA non-coding downstream 89833 29776253 ~ 29776916 (+)
G1436811 NA non-coding downstream 109816 29796236 ~ 29796485 (+)
LOC110493649 LOC106588056 other upstream 835684 28848883 ~ 28853257 (+)
LOC110495133 LOC106564943 other upstream 878316 28803282 ~ 28810516 (+)
G1435540 NA other upstream 1021236 28664354 ~ 28664979 (+)
G1434906 NA other upstream 1488634 28196696 ~ 28197581 (+)
G1436554 NA other downstream 30648 29717068 ~ 29717304 (+)
G1436829 kpra other downstream 143127 29826664 ~ 29849053 (+)
G1436967 NA other downstream 347480 30033900 ~ 30038063 (+)
LOC110493688 LOC106564992 other downstream 704281 30390554 ~ 30395746 (+)
G1437183 LOC106564893 other downstream 724323 30410743 ~ 30414934 (+)

Expression


G1436535 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G1436535 Expression in each Bioproject

Bar chart with 14 bars.
G1436535 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network