G1436921


Basic Information

Item Value
gene id G1436921
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 29973741 ~ 29974499 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU1645052
gtatatggacacaatcatgaagtggaacgacatttattggatatttcgaacttttttaacaaatcaaaaactgaaaaattgggcgtgcaaaattattcagcccctttactttcagtgcagcaaactctctccagaagttcagtgaggatctctgaatgatccaatgttgacctaaatgactaatgatgataaatacaatccacctgtgtgtaatcaagtctccgtataaatgcacctgcgctgtgatagtctcagaggtccgttaaaagcgcagagagcatcatgaagaacaaggaacacaccaggcaggtccgagatactgttgtgaagaagtttaaagccggatagcaagcgataatattgaaatggaaggagtatcagaccactgcaaatctaccaagacctggccgtccctctaaactttcagctcatacaaggagaagactgatcagagatgcagccaagaggcccatgatcactctggatgaactgcagagatctacagctgaggtgggagactctgtccataggacaacaatcagtcgtatattgcacaaatctggcctttatggaagagtggcaagaagaaagccatttcttaaagatatccataaaaagtgtcgtttaaagtttgccacaagccacctgggagacacaccaaacatgtggaagaaggtactctggtcagatgaaaccaaaattgaacaacaatgcaaaa

Function

NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU1645052 True 718 lncRNA 0.42 2 29973741 29974499
Loading

Neighbor

gene id symbol gene type direction distance location
LOC110493671 LOC106564913 coding upstream 47592 29900808 ~ 29926149 (+)
LOC118940394 NA coding upstream 93462 29871991 ~ 29880729 (+)
cygb2 LOC106564914 coding upstream 105683 29858637 ~ 29868058 (+)
LOC110493668 LOC105021619 coding upstream 152998 29818939 ~ 29820743 (+)
LOC110495157 LOC106564973 coding upstream 178315 29793566 ~ 29795426 (+)
LOC110495138 NA coding downstream 82554 30048246 ~ 30058516 (+)
LOC110493676 LOC106564902 coding downstream 148466 30122965 ~ 30140014 (+)
LOC110493681 LOC106564901 coding downstream 270724 30245223 ~ 30252675 (+)
pglyrp2 LOC106564993 coding downstream 356504 30331003 ~ 30333950 (+)
LOC110495158 LOC106588423 coding downstream 367025 30341524 ~ 30342920 (+)
G1436829 kpra non-coding upstream 124688 29826664 ~ 29849053 (+)
G1436830 NA non-coding upstream 150913 29822527 ~ 29822828 (+)
G1436826 NA non-coding upstream 151769 29821707 ~ 29821972 (+)
G1436821 NA non-coding upstream 163013 29810325 ~ 29810728 (+)
G1436951 NA non-coding downstream 42507 30017006 ~ 30019238 (+)
G1436977 LOC106588346 non-coding downstream 133277 30107776 ~ 30109514 (+)
G1436980 NA non-coding downstream 166888 30141387 ~ 30142786 (+)
G1437083 NA non-coding downstream 250877 30225376 ~ 30225611 (+)
G1436554 NA other upstream 256437 29717068 ~ 29717304 (+)
LOC110493657 LOC106564932 other upstream 946903 29022435 ~ 29026838 (+)
LOC110493649 LOC106588056 other upstream 1123210 28848883 ~ 28853257 (+)
LOC110495133 LOC106564943 other upstream 1165842 28803282 ~ 28810516 (+)
G1436967 NA other downstream 59401 30033900 ~ 30038063 (+)
LOC110493688 LOC106564992 other downstream 416202 30390554 ~ 30395746 (+)
G1437183 LOC106564893 other downstream 436244 30410743 ~ 30414934 (+)
G1437734 NA other downstream 690672 30665171 ~ 30666007 (+)
G1437911 LOC106564885 other downstream 952748 30927247 ~ 30933584 (+)

Expression

G1436921 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G1436921 Expression in each Bioproject

Bar chart with 20 bars.
G1436921 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network