G1437799



Basic Information


Item Value
gene id G1437799
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 30661117 ~ 30661458 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1646015
tatggaaccaccccacagtaacagtaatactatggtaccaccccacagtaacagatatactgtggtaccaccccacagtaacagatatactttggtaccaccccacagtatcagatatactataataccagcctacagtatcagatatactatggtaccaacccacagtatcagatatactatggtaccaacccacagtaacagatatactatggtaccatcccacagtaacagatatactatggtaccaccccacagtaacagatatactatggtaccaccccacagtatcagatatactgtagcaccaacccacagtatcagatatactatggtaccacc

Function


NR:

description
PREDICTED: proteoglycan 4-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1646015 True 342 lncRNA 0.42 1 30661117 30661458
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110493696 LOC106564971 coding downstream 35254 30624949 ~ 30625863 (-)
LOC110493695 LOC106564888 coding downstream 40075 30563150 ~ 30621042 (-)
LOC110493694 ccdc40 coding downstream 98170 30556732 ~ 30562947 (-)
LOC110493693 LOC106564890 coding downstream 112355 30536089 ~ 30548762 (-)
LOC110493691 LOC106564893 coding downstream 241907 30413145 ~ 30419210 (-)
LOC110493700 LOC106564887 coding upstream 69619 30731077 ~ 30781553 (-)
LOC110493703 LOC106564885 coding upstream 265790 30927248 ~ 30933785 (-)
LOC110493702 LOC106564884 coding upstream 272712 30934170 ~ 30937569 (-)
trnaa-ugc-131 NA coding upstream 448937 31110395 ~ 31110470 (-)
LOC110493160 LOC106564877 coding upstream 617442 31278900 ~ 31340762 (-)
G1437738 NA non-coding downstream 85617 30493729 ~ 30575500 (-)
G1437747 NA non-coding downstream 135745 30524622 ~ 30525372 (-)
G1437743 LOC106564892 non-coding downstream 137710 30513656 ~ 30523407 (-)
G1437839 NA non-coding upstream 48555 30710013 ~ 30710249 (-)
G1437842 LOC107579696 non-coding upstream 52329 30713787 ~ 30714455 (-)
G1437845 NA non-coding upstream 55235 30716693 ~ 30716905 (-)
G1438274 NA non-coding upstream 88709 30750167 ~ 30750371 (-)
G1437609 NA other downstream 192345 30467323 ~ 30468772 (-)
G1437507 NA other downstream 418154 30241450 ~ 30243706 (-)
G1437411 NA other downstream 546994 30050602 ~ 30114123 (-)
LOC110495137 LOC106564911 other downstream 717387 29926378 ~ 29979179 (-)
G1436694 NA other downstream 1048509 29612252 ~ 29612608 (-)
G1438834 NA other upstream 918809 31580267 ~ 31585322 (-)
G1439068 comd1 other upstream 1062359 31723817 ~ 31742348 (-)
G1440683 LOC106606817 other upstream 2528377 33189835 ~ 33194275 (-)

Expression


G1437799 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G1437799 Expression in each Bioproject

Bar chart with 3 bars.
G1437799 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 175.
End of interactive chart.

Co-expression Network