G1437890



Basic Information


Item Value
gene id G1437890
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 30786765 ~ 30787096 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1646113
tatatatacagtgttttaacaatgtacaaatggttaaaggacacaagggaaaataaataagcataaatatgggttgtatttacaatggtgtgtgttcttcactggttgcccttttctcgtggcaacaggtcacaaatattgctgctgtgatggcacactgtggaatttcacccagtagatatgggagtttatcaaaatttgatttgttttcgaattctttgtggatctgtgtaatctgagggaaatatgtctctctaatatggtcatacattgggcaggaggttaggaagtgcagctcagtttccacctcatttcgtgggcagtgagcacat

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1646113 True 332 lncRNA 0.39 1 30786765 30787096
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110493692 LOC106564892 coding upstream 262245 30494128 ~ 30524520 (+)
LOC110493688 LOC106564992 coding upstream 391019 30390554 ~ 30395746 (+)
LOC110493686 LOC106564896 coding upstream 410895 30364642 ~ 30375870 (+)
LOC110493685 ngap coding upstream 428765 30344671 ~ 30358000 (+)
LOC110495158 LOC106588423 coding upstream 443845 30341524 ~ 30342920 (+)
LOC110493701 LOC106564882 coding downstream 156395 30943491 ~ 31160687 (+)
LOC110493704 LOC106585659 coding downstream 379206 31166302 ~ 31198722 (+)
LOC110493705 LOC106564880 coding downstream 427834 31214930 ~ 31245583 (+)
LOC110493706 LOC106585672 coding downstream 469804 31256900 ~ 31277824 (+)
LOC110493710 LOC106564871 coding downstream 566386 31353482 ~ 31433958 (+)
G1437883 NA non-coding upstream 7406 30779034 ~ 30779359 (+)
G1437876 NA non-coding upstream 26834 30759027 ~ 30759931 (+)
G1437864 NA non-coding upstream 42998 30743403 ~ 30743767 (+)
G1437846 NA non-coding upstream 66424 30720089 ~ 30720341 (+)
G1437711 LOC106564971 non-coding upstream 161212 30624502 ~ 30625553 (+)
G1437891 NA non-coding downstream 53 30787149 ~ 30787373 (+)
G1437897 NA non-coding downstream 5633 30792729 ~ 30792975 (+)
G1437900 NA non-coding downstream 7534 30794630 ~ 30794850 (+)
G1437904 NA non-coding downstream 19775 30806871 ~ 30807078 (+)
G1437923 NA non-coding downstream 36765 30823861 ~ 30824582 (+)
G1437734 NA other upstream 120758 30665171 ~ 30666007 (+)
G1437183 LOC106564893 other upstream 371831 30410743 ~ 30414934 (+)
G1436967 NA other upstream 748702 30033900 ~ 30038063 (+)
G1436829 kpra other upstream 937712 29826664 ~ 29849053 (+)
G1437911 LOC106564885 other downstream 140151 30927247 ~ 30933584 (+)
G1438880 NA other downstream 915398 31702494 ~ 31705164 (+)
G1438941 LOC106564856 other downstream 1119426 31906522 ~ 31907498 (+)
LOC110493164 LOC106564854 other downstream 1186344 31973440 ~ 31976221 (+)
ero1b LOC106586106 other downstream 1586519 32352949 ~ 32378308 (+)

Expression


G1437890 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G1437890 Expression in each Bioproject

Bar chart with 18 bars.
G1437890 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network