G1440671



Basic Information


Item Value
gene id G1440671
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 33172960 ~ 33173177 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1649204
gtgaaaagctgtttgcatgttcttcacaaagagggcaacagatgctactgagccagatgtctgtgtgtcaggggagaagctccaggtggtatctgattttaagtaccttggcatcatacttgattccaacctctcttttaaaaagcatgtgaaaaaggtcattcaaataaccaaattcaacctagctaatttccgatttatacgaaattgtttgacta

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1649204 True 218 lncRNA 0.39 1 33172960 33173177

Neighbor


gene id symbol gene type direction distance location
LOC110493761 LOC106564817 coding downstream 32973 33108873 ~ 33139987 (-)
LOC118940398 NA coding downstream 94548 33076780 ~ 33078412 (-)
psen2 psn2 coding downstream 118775 33038160 ~ 33054185 (-)
spast LOC106564821 coding downstream 136986 33008284 ~ 33035974 (-)
LOC110495167 LOC106564987 coding downstream 211765 32947401 ~ 32961195 (-)
egln1 egln1 coding upstream 91263 33264440 ~ 33298811 (-)
LOC110493763 LOC106564812 coding upstream 239933 33413110 ~ 33515866 (-)
LOC110493764 LOC106564813 coding upstream 343143 33516320 ~ 33554522 (-)
LOC118940401 NA coding upstream 442055 33615232 ~ 33617057 (-)
LOC118940402 NA coding upstream 454323 33627500 ~ 33628031 (-)
G1440519 NA non-coding downstream 6782 33165951 ~ 33166178 (-)
G1440517 NA non-coding downstream 8884 33163750 ~ 33164076 (-)
G1440489 NA non-coding downstream 76618 33096057 ~ 33096342 (-)
G1440486 NA non-coding downstream 78201 33094313 ~ 33094759 (-)
G1440477 NA non-coding downstream 89307 33083433 ~ 33083653 (-)
G1440753 NA non-coding upstream 169438 33342615 ~ 33368145 (-)
G1440769 NA non-coding upstream 202075 33375252 ~ 33375566 (-)
G1440790 NA non-coding upstream 215808 33388985 ~ 33389317 (-)
G1441082 NA non-coding upstream 353835 33527012 ~ 33531999 (-)
G1441090 NA non-coding upstream 371940 33545117 ~ 33545341 (-)
G1439068 comd1 other downstream 1430612 31723817 ~ 31742348 (-)
G1438834 NA other downstream 1587638 31580267 ~ 31585322 (-)
LOC110493160 LOC106564877 other downstream 1888912 31278900 ~ 31340762 (-)
LOC110493700 LOC106564887 other downstream 2437374 30731077 ~ 30781553 (-)
G1437609 NA other downstream 2704188 30467323 ~ 30468772 (-)
G1440683 LOC106606817 other upstream 16658 33189835 ~ 33194275 (-)
G1440711 NA other upstream 65444 33238621 ~ 33252379 (-)
G1440781 NA other upstream 208724 33381901 ~ 33382719 (-)
G1440786 NA other upstream 212760 33385937 ~ 33386528 (-)

Expression


G1440671 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 12.
End of interactive chart.

G1440671 Expression in each Bioproject

Bar chart with 20 bars.
G1440671 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network