G1440753



Basic Information


Item Value
gene id G1440753
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 33342615 ~ 33368145 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1649295
gaattcggtgcgcaattgccagctgcttctactttaccatttgattcaggggagaaagcatgtgtccaagaacgatgtatcaatgaagagatatgtgaaaaacaccttgatgattgattctaaacaacgtttgccatgttttcagtcgatattatggagttaatttggaaaaaagttcgcgttttgaggactgaattttcagattttttttggtagccaaatgtgatgtataaaacggagctatttctaatacacaaggaatctttttggaaaaactgagcatctgctatctaactgagagtctcctcattgaaaacatcagaagttcttcaaaggtaaattattttatttgaatgcttttct

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1649295 True 363 lncRNA 0.35 2 33342615 33368145
Loading

Neighbor


gene id symbol gene type direction distance location
egln1 egln1 coding downstream 43804 33264440 ~ 33298811 (-)
LOC110493761 LOC106564817 coding downstream 202628 33108873 ~ 33139987 (-)
LOC118940398 NA coding downstream 264203 33076780 ~ 33078412 (-)
psen2 psn2 coding downstream 288430 33038160 ~ 33054185 (-)
spast LOC106564821 coding downstream 306641 33008284 ~ 33035974 (-)
LOC110493763 LOC106564812 coding upstream 44965 33413110 ~ 33515866 (-)
LOC110493764 LOC106564813 coding upstream 148175 33516320 ~ 33554522 (-)
LOC118940401 NA coding upstream 247087 33615232 ~ 33617057 (-)
LOC118940402 NA coding upstream 259355 33627500 ~ 33628031 (-)
LOC118940400 NA coding upstream 282141 33650286 ~ 33652208 (-)
G1440671 NA non-coding downstream 169438 33172960 ~ 33173177 (-)
G1440519 NA non-coding downstream 176437 33165951 ~ 33166178 (-)
G1440517 NA non-coding downstream 178539 33163750 ~ 33164076 (-)
G1440489 NA non-coding downstream 246273 33096057 ~ 33096342 (-)
G1440486 NA non-coding downstream 247856 33094313 ~ 33094759 (-)
G1440769 NA non-coding upstream 7107 33375252 ~ 33375566 (-)
G1440790 NA non-coding upstream 20840 33388985 ~ 33389317 (-)
G1441082 NA non-coding upstream 158867 33527012 ~ 33531999 (-)
G1441090 NA non-coding upstream 176972 33545117 ~ 33545341 (-)
G1441139 NA non-coding upstream 247085 33615230 ~ 33698801 (-)
G1440711 NA other downstream 90236 33238621 ~ 33252379 (-)
G1440683 LOC106606817 other downstream 148340 33189835 ~ 33194275 (-)
G1439068 comd1 other downstream 1600267 31723817 ~ 31742348 (-)
G1438834 NA other downstream 1757293 31580267 ~ 31585322 (-)
LOC110493160 LOC106564877 other downstream 2058567 31278900 ~ 31340762 (-)
G1440781 NA other upstream 13756 33381901 ~ 33382719 (-)
G1440786 NA other upstream 17792 33385937 ~ 33386528 (-)
G1442139 NA other upstream 991957 34360102 ~ 34361306 (-)
G1442336 LOC106564790 other upstream 1352282 34720427 ~ 34720792 (-)

Expression


G1440753 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 20.
End of interactive chart.

G1440753 Expression in each Bioproject

Bar chart with 18 bars.
G1440753 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network