G1441082



Basic Information


Item Value
gene id G1441082
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 33527012 ~ 33531999 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1649649
cctgtatcccatcagctatctgcacacctggtcctgatcatcatctctcctcttcataagcccggacctgacatccattccctgccggatcgttagccatgaacattactcacccggatcatttaccccattcccgcctggtcgtcggaggattccgcttccccattggatccacctatttactcccatcaactcaccaccgctgcccgctac

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1649649 True 213 lncRNA 0.54 2 33527012 33531999

Neighbor


gene id symbol gene type direction distance location
LOC110493763 LOC106564812 coding downstream 11146 33413110 ~ 33515866 (-)
egln1 egln1 coding downstream 228201 33264440 ~ 33298811 (-)
LOC110493761 LOC106564817 coding downstream 387025 33108873 ~ 33139987 (-)
LOC118940398 NA coding downstream 448600 33076780 ~ 33078412 (-)
psen2 psn2 coding downstream 472827 33038160 ~ 33054185 (-)
LOC118940401 NA coding upstream 83233 33615232 ~ 33617057 (-)
LOC118940402 NA coding upstream 95501 33627500 ~ 33628031 (-)
LOC118940400 NA coding upstream 118287 33650286 ~ 33652208 (-)
LOC118940399 NA coding upstream 128414 33660413 ~ 33662470 (-)
LOC110495170 NA coding upstream 222877 33754737 ~ 33756106 (-)
G1440790 NA non-coding downstream 137695 33388985 ~ 33389317 (-)
G1440769 NA non-coding downstream 151446 33375252 ~ 33375566 (-)
G1440753 NA non-coding downstream 158867 33342615 ~ 33368145 (-)
G1440671 NA non-coding downstream 353835 33172960 ~ 33173177 (-)
G1440519 NA non-coding downstream 360834 33165951 ~ 33166178 (-)
G1441090 NA non-coding upstream 13118 33545117 ~ 33545341 (-)
G1441139 NA non-coding upstream 83231 33615230 ~ 33698801 (-)
G1441144 NA non-coding upstream 97539 33629538 ~ 33637393 (-)
G1441353 NA non-coding upstream 238660 33770659 ~ 33770912 (-)
G1440786 NA other downstream 140484 33385937 ~ 33386528 (-)
G1440781 NA other downstream 144293 33381901 ~ 33382719 (-)
G1440711 NA other downstream 274633 33238621 ~ 33252379 (-)
G1440683 LOC106606817 other downstream 332737 33189835 ~ 33194275 (-)
G1442139 NA other upstream 828103 34360102 ~ 34361306 (-)
G1442336 LOC106564790 other upstream 1188428 34720427 ~ 34720792 (-)
G1442443 NA other upstream 1372083 34904082 ~ 34904616 (-)
LOC110493800 LOC106564782 other upstream 1528200 35023723 ~ 35061975 (-)
G1442932 rbbp9 other upstream 1696755 35228754 ~ 35232154 (-)

Expression


G1441082 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G1441082 Expression in each Bioproject

Bar chart with 16 bars.
G1441082 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network