G1442260



Basic Information


Item Value
gene id G1442260
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 34607618 ~ 34607860 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1651002
tgctggtcatttatgaacatttgaacatcttggccatgttctgttataatctccacccggcacagccagaagaggactggccaccccacatagcctggttcctctctaggtttcttcctttctagggagtttttcctagccaccgtgcttctacacctgcattgcttgctgttttggggttttaggctgggtttctgtacagcactttgagatatcagctgatgtacgaagggctatataaat

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1651002 True 243 lncRNA 0.47 1 34607618 34607860
Loading

Neighbor


gene id symbol gene type direction distance location
tmem178 LOC106564792 coding downstream 2548 34589353 ~ 34605070 (-)
LOC118940658 NA coding downstream 110949 34496620 ~ 34496669 (-)
pgap4 tmem246 coding downstream 156785 34446356 ~ 34468485 (-)
tpcn3 tpc1 coding downstream 177062 34413543 ~ 34430556 (-)
ttbk1a LOC106564797 coding downstream 209931 34348767 ~ 34397687 (-)
gemin6 gemin6 coding upstream 177677 34785537 ~ 34788361 (-)
LOC118940117 NA coding upstream 206493 34814353 ~ 34815153 (-)
LOC110493798 if4a3 coding upstream 354904 34962764 ~ 34970771 (-)
LOC118940673 NA coding upstream 357406 34965266 ~ 34965392 (-)
LOC118940674 NA coding upstream 358349 34966209 ~ 34966342 (-)
G1442243 NA non-coding downstream 42914 34564264 ~ 34564704 (-)
G1442241 NA non-coding downstream 44816 34562571 ~ 34562802 (-)
G1442194 LOC106564793 non-coding downstream 47171 34471781 ~ 34560447 (-)
G1442283 NA non-coding upstream 35964 34643824 ~ 34714014 (-)
G1442291 NA non-coding upstream 46080 34653940 ~ 34654599 (-)
G1442300 NA non-coding upstream 85003 34692863 ~ 34695051 (-)
G1442333 NA non-coding upstream 107459 34715319 ~ 34715556 (-)
G1442335 sos1 non-coding upstream 111574 34719434 ~ 34719684 (-)
G1442139 NA other downstream 246312 34360102 ~ 34361306 (-)
LOC110493763 LOC106564812 other downstream 1191265 33413110 ~ 33515866 (-)
G1440786 NA other downstream 1221090 33385937 ~ 33386528 (-)
G1440781 NA other downstream 1224899 33381901 ~ 33382719 (-)
G1440711 NA other downstream 1355239 33238621 ~ 33252379 (-)
G1442336 LOC106564790 other upstream 112567 34720427 ~ 34720792 (-)
G1442443 NA other upstream 296222 34904082 ~ 34904616 (-)
LOC110493800 LOC106564782 other upstream 452339 35023723 ~ 35061975 (-)
G1442932 rbbp9 other upstream 620894 35228754 ~ 35232154 (-)
LOC110495171 cssa12h2orf73 other upstream 1007844 35615229 ~ 35617995 (-)

Expression


G1442260 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 12.
End of interactive chart.

G1442260 Expression in each Bioproject

Bar chart with 19 bars.
G1442260 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network