G1442336 (LOC106564790)



Basic Information


Item Value
gene id G1442336
gene name LOC106564790
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 34720427 ~ 34720792 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1651088
CGGCAGTAGAGAAGTGAGAGCGGTGATAGAGGGGAGGAAAAGGAGTGGAAAAAGTCACACAAAGTCTTGATGGAAGACCATAGATGCGCAAGTGTGTACGGGAGGGTACCTCCATCACTACTCACATGGTGGGAGAAGAGCTTGGCGTCGGAGGCGATTGGCTCGCGGAACACCTTGATGATGAGGTTGAGGTCGCGCAGGTACTGTCGGACCTCGGCCATGAAGGTCTTGACCAGGTCGTAGTAGGTTTGCTCCTCGCTGGTGGACGGCTCCTCGTCCATCAGGGGGAAACCGCTGATGTCCTCCTCATCCTGGTGGAACATGTCCATCAGAACCTGGAGATGAGGGGGAATAGAAGTGGCCAGA

Function


NR:

description
son of sevenless homolog 1-like, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1651088 True 366 TUCP 0.55 1 34720427 34720792
Loading

Neighbor


gene id symbol gene type direction distance location
tmem178 LOC106564792 coding downstream 115357 34589353 ~ 34605070 (-)
LOC118940658 NA coding downstream 223758 34496620 ~ 34496669 (-)
pgap4 tmem246 coding downstream 269594 34446356 ~ 34468485 (-)
tpcn3 tpc1 coding downstream 289871 34413543 ~ 34430556 (-)
ttbk1a LOC106564797 coding downstream 322740 34348767 ~ 34397687 (-)
gemin6 gemin6 coding upstream 64745 34785537 ~ 34788361 (-)
LOC118940117 NA coding upstream 93561 34814353 ~ 34815153 (-)
LOC110493798 if4a3 coding upstream 241972 34962764 ~ 34970771 (-)
LOC118940673 NA coding upstream 244474 34965266 ~ 34965392 (-)
LOC118940674 NA coding upstream 245417 34966209 ~ 34966342 (-)
G1442335 sos1 non-coding downstream 743 34719434 ~ 34719684 (-)
G1442333 NA non-coding downstream 4871 34715319 ~ 34715556 (-)
G1442283 NA non-coding downstream 6413 34643824 ~ 34714014 (-)
G1442300 NA non-coding downstream 25376 34692863 ~ 34695051 (-)
G1442291 NA non-coding downstream 65828 34653940 ~ 34654599 (-)
G1442337 NA non-coding upstream 1905 34722697 ~ 34723115 (-)
G1442340 NA non-coding upstream 5540 34726332 ~ 34726950 (-)
G1442341 NA non-coding upstream 10678 34731470 ~ 34731787 (-)
G1442347 NA non-coding upstream 16151 34736943 ~ 34776594 (-)
G1442316 NA non-coding upstream 18994 34739786 ~ 34839092 (-)
G1442139 NA other downstream 359121 34360102 ~ 34361306 (-)
LOC110493763 LOC106564812 other downstream 1304074 33413110 ~ 33515866 (-)
G1440786 NA other downstream 1333899 33385937 ~ 33386528 (-)
G1440781 NA other downstream 1337708 33381901 ~ 33382719 (-)
G1440711 NA other downstream 1468048 33238621 ~ 33252379 (-)
G1442443 NA other upstream 183290 34904082 ~ 34904616 (-)
LOC110493800 LOC106564782 other upstream 339407 35023723 ~ 35061975 (-)
G1442932 rbbp9 other upstream 507962 35228754 ~ 35232154 (-)
LOC110495171 cssa12h2orf73 other upstream 894912 35615229 ~ 35617995 (-)
LOC110493173 slc29a1 other upstream 1259189 35979898 ~ 36012831 (-)

Expression


G1442336(LOC106564790) Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 0.6.
End of interactive chart.

G1442336(LOC106564790) Expression in each Bioproject

Bar chart with 8 bars.
G1442336(LOC106564790) Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 4.
End of interactive chart.

Co-expression Network