G1442443



Basic Information


Item Value
gene id G1442443
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 34904082 ~ 34904616 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1651205
ctctgtggagatgggaggaccttccaaaaggacaaccatctctgcagcactctaacaatcagaccttcatggtagagtggccagacagaagccactcctcagtaaaaggcacatgacagcctgcttggagttttccaaaaggcacctaaaggactctcagacaatgagaaacaagattctctggtctgatgaaaccaagattgaactctttgttctaaatgccaagtgtcacgtctggaggaaacctggcaccgtccctacggtgaagcatagtggtggcagcatcatgcagtggggatgtttttcagcggcagggactgggagactagccaggatcaagggaaatatgaatggagcaaagtatagagtcatcctttatgaaaacctgctccagagtgcttagtacctcagactggggaaaaggctcaccttccaacaggacaacgaccctaagcacacagccaaaacaacacttgagtggcccagccagagcccggacttgaacctgatcgaacatctctggagagaccagaaa

Function


NR:

description
TC1-like transposase

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1651205 True 535 TUCP 0.49 1 34904082 34904616

Neighbor


gene id symbol gene type direction distance location
LOC118940117 NA coding downstream 88929 34814353 ~ 34815153 (-)
gemin6 gemin6 coding downstream 115721 34785537 ~ 34788361 (-)
tmem178 LOC106564792 coding downstream 299012 34589353 ~ 34605070 (-)
LOC118940658 NA coding downstream 407413 34496620 ~ 34496669 (-)
pgap4 tmem246 coding downstream 453249 34446356 ~ 34468485 (-)
LOC110493798 if4a3 coding upstream 58148 34962764 ~ 34970771 (-)
LOC118940673 NA coding upstream 60650 34965266 ~ 34965392 (-)
LOC118940674 NA coding upstream 61593 34966209 ~ 34966342 (-)
LOC110493799 LOC106564784 coding upstream 73928 34976092 ~ 35008618 (-)
LOC118940098 NA coding upstream 109447 35014063 ~ 35019078 (-)
G1442442 NA non-coding downstream 889 34901888 ~ 34903193 (-)
G1442316 NA non-coding downstream 64990 34739786 ~ 34839092 (-)
G1442347 NA non-coding downstream 127488 34736943 ~ 34776594 (-)
G1442372 LOC106564790 non-coding downstream 135843 34766558 ~ 34768239 (-)
G1442365 NA non-coding downstream 142128 34761190 ~ 34761954 (-)
G1442458 NA non-coding upstream 10350 34914966 ~ 34915185 (-)
G1442651 NA non-coding upstream 20932 34925548 ~ 34929740 (-)
G1442694 NA non-coding upstream 110572 35015188 ~ 35015396 (-)
G1442699 NA non-coding upstream 115034 35019650 ~ 35019878 (-)
G1442336 LOC106564790 other downstream 183290 34720427 ~ 34720792 (-)
G1442139 NA other downstream 542776 34360102 ~ 34361306 (-)
LOC110493763 LOC106564812 other downstream 1487729 33413110 ~ 33515866 (-)
G1440786 NA other downstream 1517554 33385937 ~ 33386528 (-)
G1440781 NA other downstream 1521363 33381901 ~ 33382719 (-)
LOC110493800 LOC106564782 other upstream 155583 35023723 ~ 35061975 (-)
G1442932 rbbp9 other upstream 324138 35228754 ~ 35232154 (-)
LOC110495171 cssa12h2orf73 other upstream 711088 35615229 ~ 35617995 (-)
LOC110493173 slc29a1 other upstream 1075365 35979898 ~ 36012831 (-)
LOC118940405 slc29a1 other upstream 1184668 36087429 ~ 36123409 (-)

Expression


G1442443 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G1442443 Expression in each Bioproject

Bar chart with 21 bars.
G1442443 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network