G1442694



Basic Information


Item Value
gene id G1442694
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 35015188 ~ 35015396 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1651500
ggtctgatactccttccatttcaatattatcgcttgcacagtgctccttgggatgtttaaagcttgggaaatctttttgtatccaaatccgtctttaaacttcttcacaacagtatctcagacctgcctggtgtgttccttgttcttcatgatgctctttgcgcttttaacggacctctgagactatcacagtgcaggtgcatttatac

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1651500 True 209 lncRNA 0.42 1 35015188 35015396

Neighbor


gene id symbol gene type direction distance location
LOC110493799 LOC106564784 coding downstream 6570 34976092 ~ 35008618 (-)
LOC110493798 if4a3 coding downstream 44417 34962764 ~ 34970771 (-)
LOC118940674 NA coding downstream 48846 34966209 ~ 34966342 (-)
LOC118940673 NA coding downstream 49796 34965266 ~ 34965392 (-)
LOC118940117 NA coding downstream 200035 34814353 ~ 34815153 (-)
LOC110493800 LOC106564782 coding upstream 8327 35023723 ~ 35061975 (-)
LOC110493803 LOC106564778 coding upstream 167970 35183366 ~ 35199206 (-)
zgc:194981 LOC106564776 coding upstream 188152 35203548 ~ 35205645 (-)
LOC110493805 LOC106564776 coding upstream 204358 35219754 ~ 35227920 (-)
polr3f polr3f coding upstream 217928 35233324 ~ 35238873 (-)
G1442651 NA non-coding downstream 85448 34925548 ~ 34929740 (-)
G1442458 NA non-coding downstream 100003 34914966 ~ 34915185 (-)
G1442442 NA non-coding downstream 111995 34901888 ~ 34903193 (-)
G1442372 LOC106564790 non-coding downstream 246949 34766558 ~ 34768239 (-)
G1442699 NA non-coding upstream 4254 35019650 ~ 35019878 (-)
G1442702 NA non-coding upstream 6786 35022182 ~ 35022483 (-)
G1442680 NA non-coding upstream 38469 35053865 ~ 35054961 (-)
G1442681 NA non-coding upstream 47750 35063146 ~ 35063719 (-)
G1442443 NA other downstream 110572 34904082 ~ 34904616 (-)
G1442336 LOC106564790 other downstream 294396 34720427 ~ 34720792 (-)
G1442139 NA other downstream 653882 34360102 ~ 34361306 (-)
LOC110493763 LOC106564812 other downstream 1598835 33413110 ~ 33515866 (-)
G1440786 NA other downstream 1628660 33385937 ~ 33386528 (-)
G1442932 rbbp9 other upstream 213358 35228754 ~ 35232154 (-)
LOC110495171 cssa12h2orf73 other upstream 600308 35615229 ~ 35617995 (-)
LOC110493173 slc29a1 other upstream 964585 35979898 ~ 36012831 (-)
LOC118940405 slc29a1 other upstream 1073888 36087429 ~ 36123409 (-)

Expression


G1442694 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G1442694 Expression in each Bioproject

Bar chart with 14 bars.
G1442694 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 80.
End of interactive chart.

Co-expression Network