G1443370 (slc29a1)


Basic Information

Item Value
gene id G1443370
gene name slc29a1
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 36002671 ~ 36003823 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU1652254
GTCAACGTGAAAAAGGGGAGGGGTGCCATCTCTATTTTAACCAAAATGGCTGTCAGAAGAAACACCACCAAAATCACTGCCAGGCTGCCCATGATCCGAAACTTCTGAGGAATCCTTTGATGCAGGACTGAGTTGAGACAGGTGAAGGCCAGTAAAGGCACCATGGCACAAAGTGTCATTACGTTATTGAACTTGGCCTCCAAAAGGCTACGGTTGTTCCCTTCT

Function

symbol description
slc29a1 Enables neurotransmitter transmembrane transporter activity; purine nucleoside transmembrane transporter activity; and uridine transmembrane transporter activity. Involved in neurotransmitter reuptake; nucleoside transport; and pyrimidine-containing compound transmembrane transport. Located in apical plasma membrane and basolateral plasma membrane. Part of plasma membrane.

NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU1652254 True 225 lncRNA 0.48 2 36002671 36003823

Neighbor

gene id symbol gene type direction distance location
LOC110493827 tmem63b coding upstream 47024 35855110 ~ 35955647 (+)
LOC110493822 sde2 coding upstream 155211 35825533 ~ 35847460 (+)
LOC110493823 sde2 coding upstream 155214 35838159 ~ 35847457 (+)
LOC110493821 LOC106565008 coding upstream 178576 35794345 ~ 35824095 (+)
LOC100135837 LOC100135837 coding upstream 208948 35776496 ~ 35793723 (+)
LOC118940407 NA coding downstream 230469 36234292 ~ 36242642 (+)
LOC110493841 LOC106565021 coding downstream 406380 36410203 ~ 36417254 (+)
LOC110493174 LOC106582647 coding downstream 488459 36492282 ~ 36557771 (+)
mmp24 mmp24 coding downstream 570148 36573971 ~ 36641719 (+)
LOC118940420 NA coding downstream 656525 36660348 ~ 36665818 (+)
G1443357 NA non-coding upstream 26865 35975585 ~ 35975806 (+)
G1443356 NA non-coding upstream 27903 35974543 ~ 35974768 (+)
G1443353 NA non-coding upstream 31462 35970917 ~ 35971209 (+)
G1443352 NA non-coding upstream 32714 35969590 ~ 35969957 (+)
G1443349 NA non-coding upstream 40230 35962211 ~ 35962441 (+)
G1443400 NA non-coding downstream 116077 36119900 ~ 36120323 (+)
G1443401 NA non-coding downstream 116896 36120719 ~ 36121035 (+)
G1443402 NA non-coding downstream 117617 36121440 ~ 36122037 (+)
G1443403 NA non-coding downstream 118281 36122104 ~ 36122464 (+)
G1443414 LOC106565014 non-coding downstream 157205 36161028 ~ 36162245 (+)
G1443251 NA other upstream 250881 35746872 ~ 35751790 (+)
G1443221 NA other upstream 258029 35673964 ~ 35744642 (+)
LOC110493802 LOC106564779 other upstream 818131 35120694 ~ 35184540 (+)
LOC110493778 LOC106564798 other upstream 1700062 34290017 ~ 34317682 (+)
G1441315 NA other upstream 2026196 33976193 ~ 33976475 (+)
G1443844 NA other downstream 327412 36331235 ~ 36375374 (+)
G1444198 LOC106565031 other downstream 853743 36857566 ~ 36861009 (+)
G1444933 NA other downstream 1398374 37402197 ~ 37402492 (+)

Expression


Co-expression Network