G1443821


Basic Information

Item Value
gene id G1443821
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 36170870 ~ 36174051 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU1652741
cacccatctacagggtccgtaggattttggacatgcgtcctcggggccgtggtcatcagtacctagtagattgggaggggtacggtcctgaggagaggagttgggttccctctcgggacgtgctggaccgtgcgctgatcgatgatttcctccgttgccgccaggcttcctcctcgagtgcgccaggaggcgctcggtgagtgggggggtactgtcatgtattgtcatgttgtgtcttgtttctgtcctttcccttcaccctgtctccctctgctggtcgttattaggttaccttttctccccctcttttccccagctgttccttgtctcctcctaactacctcgtcaccccttttcccacctgttccctttttccctctgattagtcctctatatctctctctgtttttgttcctgtctttgtcggattctcgtttgtgttactcatgcctgaaccagactatcgtcgtgtttgctgcaaccttgtcctgtcctgtcggaatctgcctgttcagctaaccttgttctgtcctgtcggaatctgcctgtccatctgagcctacgtgtgtttcgtcattaaagaaactctgttttgttaattcgcttttgggtcctcattcacgcaccgtaacagaagaatccgaccaagaatgg

Function

NR:

description
PREDICTED: uncharacterized protein LOC109108415

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU1652741 True 654 TUCP 0.52 2 36170870 36174051

Neighbor

gene id symbol gene type direction distance location
LOC118940406 LOC106565014 coding downstream 8626 36136653 ~ 36162244 (-)
LOC118940405 slc29a1 coding downstream 47461 36087429 ~ 36123409 (-)
LOC110493839 slc29a1 coding downstream 89242 36053017 ~ 36081628 (-)
LOC118940404 slc29a1 coding downstream 123544 36018603 ~ 36047326 (-)
LOC110493173 slc29a1 coding downstream 158039 35979898 ~ 36012831 (-)
LOC118940118 LOC107745493 coding upstream 18524 36192575 ~ 36192949 (-)
LOC110493831 zgc:163040 coding upstream 19447 36193498 ~ 36204259 (-)
LOC118940408 LOC108414267 coding upstream 25263 36199314 ~ 36201171 (-)
LOC118940414 LOC101068541 coding upstream 34229 36208280 ~ 36208909 (-)
LOC118940119 LOC106906734 coding upstream 35135 36209186 ~ 36209572 (-)
G1443733 NA non-coding downstream 34854 36134101 ~ 36136016 (-)
G1443797 NA non-coding downstream 119092 36050693 ~ 36051778 (-)
G1443777 NA non-coding downstream 210871 35959737 ~ 35959999 (-)
G1443732 NA non-coding downstream 212996 35957566 ~ 35957874 (-)
G1443681 NA non-coding downstream 291780 35834858 ~ 35879090 (-)
G1443826 NA non-coding upstream 7630 36181681 ~ 36182043 (-)
G1443827 NA non-coding upstream 11909 36185960 ~ 36186248 (-)
G1443832 NA non-coding upstream 50808 36224859 ~ 36225528 (-)
G1443823 NA non-coding upstream 59981 36234032 ~ 36237287 (-)
G1443824 NA non-coding upstream 63520 36237571 ~ 36238665 (-)
LOC110495171 cssa12h2orf73 other downstream 552948 35615229 ~ 35617995 (-)
G1442932 rbbp9 other downstream 938716 35228754 ~ 35232154 (-)
LOC110493800 LOC106564782 other downstream 1108895 35023723 ~ 35061975 (-)
LOC118940419 LOC103395674 other upstream 113130 36287181 ~ 36287741 (-)
G1443835 NA other upstream 122881 36296932 ~ 36297265 (-)
dynlrb1 LOC106565026 other upstream 506983 36681034 ~ 36686599 (-)
G1444775 NA other upstream 994930 37153825 ~ 37170504 (-)
G1446798 NA other upstream 2674714 38848765 ~ 38849084 (-)

Expression

G1443821 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G1443821 Expression in each Bioproject

Bar chart with 19 bars.
G1443821 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network