G1444613



Basic Information


Item Value
gene id G1444613
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 36892344 ~ 36892558 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1653612
cacctacaccacccgatgttacaggaaggccataaagatcatcaaggacaacaaccacccaagccactgcctgttcaccccgctatcgtccagaaggcgaggtcagtacaggtgcatcaaagctgggaccgagagactgaaaaacagcttctagctcaaggccatcagactgttaaacagccaccactaacattgagtggctgctgccaacacac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1653612 True 215 lncRNA 0.52 1 36892344 36892558
Loading

Neighbor


gene id symbol gene type direction distance location
LOC118940421 NA coding downstream 11762 36879258 ~ 36880582 (-)
cpne1 LOC106565032 coding downstream 19959 36807147 ~ 36872385 (-)
LOC110493847 LOC106565031 coding downstream 19964 36857428 ~ 36872380 (-)
dynlrb1 LOC106565026 coding downstream 205745 36681034 ~ 36686599 (-)
LOC110493843 NA coding downstream 225717 36647727 ~ 36666627 (-)
LOC110493176 LOC106565052 coding upstream 14425 36906983 ~ 36910279 (-)
LOC110493849 LOC106582652 coding upstream 17967 36910525 ~ 36953324 (-)
LOC110493851 LOC106565035 coding upstream 107750 37000017 ~ 37002560 (-)
LOC110493854 ywhaz coding upstream 150370 37042928 ~ 37053260 (-)
LOC110493856 NA coding upstream 172671 37065229 ~ 37067085 (-)
G1444611 NA non-coding downstream 7784 36884299 ~ 36884560 (-)
G1444607 NA non-coding downstream 15224 36875331 ~ 36877120 (-)
G1444534 NA non-coding downstream 154299 36736395 ~ 36738045 (-)
G1444519 NA non-coding downstream 228359 36663744 ~ 36663985 (-)
G1444515 NA non-coding downstream 238423 36653579 ~ 36653921 (-)
G1444633 NA non-coding upstream 33583 36926141 ~ 36926354 (-)
G1444638 NA non-coding upstream 39500 36932058 ~ 36932377 (-)
G1444681 NA non-coding upstream 104016 36996574 ~ 36996898 (-)
G1444683 NA non-coding upstream 105845 36998403 ~ 36998621 (-)
G1443835 NA other downstream 595079 36296932 ~ 36297265 (-)
LOC118940419 LOC103395674 other downstream 604859 36287181 ~ 36287741 (-)
G1443821 NA other downstream 718293 36170870 ~ 36174051 (-)
LOC118940405 slc29a1 other downstream 777962 36087429 ~ 36123409 (-)
G1444775 NA other upstream 276423 37153825 ~ 37170504 (-)
G1446798 NA other upstream 1956207 38848765 ~ 38849084 (-)
G1447184 NA other upstream 2061696 38954254 ~ 39011535 (-)
LOC110493879 NA other upstream 2540071 39432200 ~ 39435824 (-)
manbal manbl other upstream 2977457 39868935 ~ 39872022 (-)

Expression


G1444613 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G1444613 Expression in each Bioproject

Bar chart with 13 bars.
G1444613 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network