G1444683



Basic Information


Item Value
gene id G1444683
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 36998403 ~ 36998621 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1653683
TGGTTAATGTGACGCCGCCACATTATGTCTGGGCTCACTTGAACCTGGTAAGTTCTGGGTCCCGTTTGTGTGTGTACGGTCCCTCTTGTCCATTTCCCTCCTCTTCTGTAGTCTCGCACCATCACTTCCTGTCCTGTTTGGAGATGGCGCTCCCGGCCACCGGAGAGCATCTTGCTTGTTTGTTCAACACTTCATTACGCCTGTTTGGCTTCATGATGT

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1653683 True 219 lncRNA 0.52 1 36998403 36998621
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110493849 LOC106582652 coding downstream 45079 36910525 ~ 36953324 (-)
LOC110493176 LOC106565052 coding downstream 88124 36906983 ~ 36910279 (-)
LOC118940421 NA coding downstream 117821 36879258 ~ 36880582 (-)
cpne1 LOC106565032 coding downstream 126018 36807147 ~ 36872385 (-)
LOC110493851 LOC106565035 coding upstream 1687 37000017 ~ 37002560 (-)
LOC110493854 ywhaz coding upstream 44307 37042928 ~ 37053260 (-)
LOC110493856 NA coding upstream 66608 37065229 ~ 37067085 (-)
angpt4 LOC106565038 coding upstream 85350 37083971 ~ 37128501 (-)
tmem74b LOC106565039 coding upstream 265321 37263942 ~ 37295244 (-)
G1444681 NA non-coding downstream 1505 36996574 ~ 36996898 (-)
G1444638 NA non-coding downstream 66026 36932058 ~ 36932377 (-)
G1444633 NA non-coding downstream 72049 36926141 ~ 36926354 (-)
G1444613 NA non-coding downstream 105845 36892344 ~ 36892558 (-)
G1444611 NA non-coding downstream 113843 36884299 ~ 36884560 (-)
G1444684 NA non-coding upstream 4509 37003130 ~ 37003411 (-)
G1444689 NA non-coding upstream 15042 37013663 ~ 37013922 (-)
G1444690 NA non-coding upstream 16771 37015392 ~ 37015621 (-)
G1444695 NA non-coding upstream 22370 37020991 ~ 37021199 (-)
dynlrb1 LOC106565026 other downstream 311836 36681034 ~ 36686599 (-)
G1443835 NA other downstream 701138 36296932 ~ 36297265 (-)
LOC118940419 LOC103395674 other downstream 710918 36287181 ~ 36287741 (-)
G1443821 NA other downstream 824352 36170870 ~ 36174051 (-)
LOC118940405 slc29a1 other downstream 884021 36087429 ~ 36123409 (-)
G1444775 NA other upstream 170360 37153825 ~ 37170504 (-)
G1446798 NA other upstream 1850144 38848765 ~ 38849084 (-)
G1447184 NA other upstream 1955633 38954254 ~ 39011535 (-)
LOC110493879 NA other upstream 2434008 39432200 ~ 39435824 (-)
manbal manbl other upstream 2871394 39868935 ~ 39872022 (-)

Expression


G1444683 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 5.
End of interactive chart.

G1444683 Expression in each Bioproject

Bar chart with 19 bars.
G1444683 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network