G1446798



Basic Information


Item Value
gene id G1446798
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 38848765 ~ 38849084 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1655962
agtcagcatggagcagccagagccgccagtcagcatggagcagccagagccgccagtcagcatggagcagccagagccgacagtcagcatggagcagccagagtcgccagtcagcatggagcagccagtcagcatggagcagccagagcagccagtcagcatggagcagccagagcagccagtcagcatggagcagccagagctgccagtcagcatggagcttccagatccgccagtcagccaggatccgctattcagccaggatc

Function


NR:

description
PREDICTED: major latex allergen Hev b 5-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1655962 True 266 TUCP 0.62 2 38848765 38849084
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110493871 LOC106565051 coding downstream 146907 38688427 ~ 38701858 (-)
ergic3 LOC106565050 coding downstream 162829 38669546 ~ 38685936 (-)
mych myc2 coding downstream 193856 38651076 ~ 38654909 (-)
ptprt LOC106565046 coding downstream 553636 37882119 ~ 38295129 (-)
LOC110493863 NA coding downstream 1087870 37755312 ~ 37760895 (-)
LOC110495173 NA coding upstream 23904 38872988 ~ 38890301 (-)
eif2s2 LOC106565058 coding upstream 264912 39113996 ~ 39119861 (-)
ahcy LOC104945811 coding upstream 341182 39190266 ~ 39208968 (-)
LOC110493874 LOC106565064 coding upstream 365566 39214650 ~ 39229788 (-)
LOC110493877 cssa12h20orf85 coding upstream 399216 39248300 ~ 39253270 (-)
G1446693 NA non-coding downstream 134639 38713671 ~ 38714126 (-)
G1446528 NA non-coding downstream 218313 38630166 ~ 38630452 (-)
G1446349 NA non-coding downstream 496810 38351690 ~ 38351955 (-)
G1446341 NA non-coding downstream 503727 38344661 ~ 38345038 (-)
G1446332 NA non-coding downstream 526471 38321978 ~ 38322294 (-)
G1446803 NA non-coding upstream 7884 38856968 ~ 38857200 (-)
G1446805 NA non-coding upstream 8644 38857728 ~ 38857942 (-)
G1446806 NA non-coding upstream 8947 38858031 ~ 38858311 (-)
G1447262 NA non-coding upstream 239040 39088124 ~ 39088399 (-)
G1447263 NA non-coding upstream 240467 39089551 ~ 39091214 (-)
G1444775 NA other downstream 1678261 37153825 ~ 37170504 (-)
dynlrb1 LOC106565026 other downstream 2162198 36681034 ~ 36686599 (-)
G1443835 NA other downstream 2551500 36296932 ~ 36297265 (-)
LOC118940419 LOC103395674 other downstream 2561280 36287181 ~ 36287741 (-)
G1443821 NA other downstream 2674714 36170870 ~ 36174051 (-)
G1447184 NA other upstream 105170 38954254 ~ 39011535 (-)
LOC110493879 NA other upstream 583545 39432200 ~ 39435824 (-)
manbal manbl other upstream 1020931 39868935 ~ 39872022 (-)
G1450874 NA other upstream 3178390 42027474 ~ 42028006 (-)
G1450985 NA other upstream 3253592 42102676 ~ 42103137 (-)

Expression


G1446798 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G1446798 Expression in each Bioproject

Bar chart with 20 bars.
G1446798 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network