G1447998



Basic Information


Item Value
gene id G1447998
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 39799936 ~ 39800236 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1657230
ctccatgctgactggcggccctggctgctccatgctgactggcggccctggctgctccatgctgactggcggccctggctgctccatgctgactggcggccctggctgctccatgctgactggcggccctggctgctccatgctaactggcagctctggcggctccttgcagactggcagctctggcggctccttgcagactggcagctttggcggcatcctgcagactggcagctctggcagctccatgcagactggcagctctatgcagactggcagctccttgcagactggcagctcc

Function


NR:

description
PREDICTED: major latex allergen Hev b 5-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1657230 True 301 TUCP 0.66 1 39799936 39800236

Neighbor


gene id symbol gene type direction distance location
LOC110493884 LOC106565072 coding upstream 103910 39651864 ~ 39696026 (+)
ccndbp1 ccndbp1 coding upstream 278438 39500696 ~ 39521498 (+)
pmepa1 pmepa1 coding upstream 380125 39342991 ~ 39426900 (+)
LOC110493876 NA coding upstream 574212 39220263 ~ 39225724 (+)
asip1 asip coding upstream 615976 39178717 ~ 39183960 (+)
LOC110493887 LOC106565076 coding downstream 106037 39906273 ~ 39917797 (+)
LOC110493888 LOC106565077 coding downstream 148390 39948626 ~ 40269835 (+)
LOC110493889 LOC106565080 coding downstream 512640 40312876 ~ 40367740 (+)
LOC118940425 dnttip1 coding downstream 567521 40367757 ~ 40378949 (+)
LOC118940426 LOC106565291 coding downstream 582949 40383185 ~ 40385420 (+)
G1447648 NA non-coding upstream 32691 39720797 ~ 39767245 (+)
G1447558 NA non-coding upstream 82056 39697218 ~ 39717880 (+)
G1447563 NA non-coding upstream 192388 39606969 ~ 39607548 (+)
G1447480 NA non-coding upstream 365390 39429976 ~ 39434546 (+)
G1447017 NA non-coding upstream 676968 39122767 ~ 39122968 (+)
G1448007 NA non-coding downstream 5708 39805944 ~ 39806156 (+)
G1448130 NA non-coding downstream 104024 39904260 ~ 39904461 (+)
G1448150 NA non-coding downstream 140689 39940925 ~ 39941301 (+)
G1448174 NA non-coding downstream 187298 39987534 ~ 39988009 (+)
G1448318 NA non-coding downstream 473624 40273860 ~ 40274685 (+)
G1446149 NA other upstream 1489072 38309129 ~ 38310864 (+)
rbl1 rbl1 other upstream 2211209 37538220 ~ 37588797 (+)
chd6 NA other upstream 2359524 37406926 ~ 37514061 (+)
G1444933 NA other upstream 2397444 37402197 ~ 37402492 (+)
LOC110493893 cdh22 other downstream 1149306 40767465 ~ 41084819 (+)
LOC110493897 LOC106565282 other downstream 1841887 41641874 ~ 41706180 (+)
G1450387 NA other downstream 1992647 41792883 ~ 41890515 (+)
G1451948 LOC570405 other downstream 3528350 43328586 ~ 43459832 (+)
G1451956 LOC106958509 other downstream 3528863 43329099 ~ 43409816 (+)

Expression


G1447998 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

G1447998 Expression in each Bioproject

Bar chart with 18 bars.
G1447998 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 750.
End of interactive chart.

Co-expression Network