G1449823



Basic Information


Item Value
gene id G1449823
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 41209779 ~ 41210094 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1659146
cagaaaccctagacccactccaatttgcataccgcccaaacactgccctttcccacctggacaaaaggaacacctatgtgagaatgctgttcattgactacaactcagtgttcaacaccatagtaccctcaaagctcatcaccaagctaaggatcctgggactaaacacctccctctgcaactggatcctggacttcctgacaggccaaccccaggtggtgagggtaggtagcaacacatcagccacgctgatcctcaacacctgagctccccaggggtgcatgctcagccccctcctatactccctgtttaccca

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1659146 True 316 lncRNA 0.53 1 41209779 41210094

Neighbor


gene id symbol gene type direction distance location
LOC110493893 cdh22 coding upstream 124960 40767465 ~ 41084819 (+)
LOC110493184 LOC106565288 coding upstream 735090 40448527 ~ 40474689 (+)
LOC118940426 LOC106565291 coding upstream 824359 40383185 ~ 40385420 (+)
LOC118940425 dnttip1 coding upstream 830830 40367757 ~ 40378949 (+)
LOC110493889 LOC106565080 coding upstream 842039 40312876 ~ 40367740 (+)
LOC110493894 LOC106565283 coding downstream 320079 41530173 ~ 41547714 (+)
LOC110493897 LOC106565282 coding downstream 431780 41641874 ~ 41706180 (+)
LOC110493901 LOC106565279 coding downstream 612268 41822362 ~ 41887681 (+)
LOC110493904 LOC106565276 coding downstream 819896 42029990 ~ 42108742 (+)
LOC110493907 LOC106565273 coding downstream 1119471 42329565 ~ 42407845 (+)
G1449646 NA non-coding upstream 120163 41089383 ~ 41089616 (+)
G1449413 NA non-coding upstream 129618 41079941 ~ 41080161 (+)
G1449409 NA non-coding upstream 133908 41075546 ~ 41075871 (+)
G1449408 NA non-coding upstream 134453 41075095 ~ 41075326 (+)
G1449362 NA non-coding upstream 233395 40962556 ~ 40976384 (+)
G1449847 NA non-coding downstream 12387 41222481 ~ 41222687 (+)
G1449858 NA non-coding downstream 21491 41231585 ~ 41231814 (+)
G1449860 NA non-coding downstream 21791 41231885 ~ 41232090 (+)
G1449866 NA non-coding downstream 27739 41237833 ~ 41238144 (+)
G1450071 NA non-coding downstream 179912 41390006 ~ 41390214 (+)
G1447998 NA other upstream 1409543 39799936 ~ 39800236 (+)
pmepa1 pmepa1 other upstream 1782879 39342991 ~ 39426900 (+)
G1446149 NA other upstream 2898915 38309129 ~ 38310864 (+)
rbl1 rbl1 other upstream 3621052 37538220 ~ 37588797 (+)
G1450387 NA other downstream 582789 41792883 ~ 41890515 (+)
G1451948 LOC570405 other downstream 2118492 43328586 ~ 43459832 (+)
G1451956 LOC106958509 other downstream 2119005 43329099 ~ 43409816 (+)
G1452359 NA other downstream 2272166 43482260 ~ 43483693 (+)

Expression


G1449823 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G1449823 Expression in each Bioproject

Bar chart with 19 bars.
G1449823 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network