G1458499


Basic Information

Item Value
gene id G1458499
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 48864504 ~ 48865365 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU1668618
gcaataatattgaaatggaaggagtatcagaccactgcaaatctaccaagacctggccgtccctctaaactttcagctcatacaaggaaaagactgatcagagatgcagccaagaggcccatgatcactctggatgaactgcagagatctacagctgaggtgggagactctgtccataggacaacaatcagtcatatattgcacaaatctggcctttatggaagagtggcaagaagaaagccatttcttaaagatatccataaaatgtgtcgtttaaagtttgccacaagccacctgggagacacaccaaacatgtggaagaaggtgctctggtcagatgaaaccaaaattgaactttttggcaacaatgcaaaacgttatgtttggcgtaaaagcaacacagctcatcacactgaacacaacatccccactgtcaaacatggtggtggcagcatcatggtttgggcctgcttttcttcagcagggacagggaagatggttaaaattgatgggaagatggatggagccaaatacaggaccattctggaagaaaacctgatggagtctgcaaaagacctgagactgggacggagatttgtcttccaacaagacaatgatccaaaacaaaaagcaaaatctacaatggaatggttcaaaaataaacatatccaggtgttagaatggccaagtcaaagtccagacctgaatccaatcgagaatctgtggaaagaactgaaaactgctgttcacaaatgctctccatccaacctcactgagctcgagctgttttgcaaggaggaatgggaaaaaatgtcagtctctcgatgtgcaaaactgatagagacataccccaagcgactta

Function

NR:

description
Tc1-like transporase

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU1668618 True 862 TUCP 0.44 1 48864504 48865365
Loading

Neighbor

gene id symbol gene type direction distance location
rad54l2 rad54l2 coding downstream 191867 48635871 ~ 48672637 (-)
rassf1 LOC106565172 coding downstream 242255 48613838 ~ 48624034 (-)
tusc2b LOC106565173 coding downstream 250839 48608214 ~ 48613665 (-)
LOC110494019 LOC106565174 coding downstream 264365 48585415 ~ 48600139 (-)
LOC110495175 abhea coding downstream 289720 48571881 ~ 48574784 (-)
LOC110494027 NA coding upstream 148842 49014207 ~ 49020716 (-)
LOC118940475 NA coding upstream 158034 49023399 ~ 49131370 (-)
LOC110494029 LOC106565163 coding upstream 276673 49142038 ~ 49168790 (-)
il17rc LOC106565162 coding upstream 307458 49172823 ~ 49183776 (-)
LOC110494030 LOC106565161 coding upstream 319323 49184688 ~ 49224409 (-)
G1458486 NA non-coding downstream 15914 48848375 ~ 48848590 (-)
G1458484 NA non-coding downstream 20621 48843565 ~ 48843883 (-)
G1458479 NA non-coding downstream 26337 48837951 ~ 48838167 (-)
G1458472 NA non-coding downstream 39942 48824290 ~ 48824562 (-)
G1458423 NA non-coding downstream 49845 48803267 ~ 48814659 (-)
G1458512 NA non-coding upstream 70065 48935430 ~ 48937986 (-)
G1458596 NA non-coding upstream 189678 49055043 ~ 49110974 (-)
G1458866 NA non-coding upstream 523101 49388466 ~ 49389336 (-)
G1455801 NA other downstream 2268185 46595488 ~ 46596319 (-)
G1455240 NA other downstream 3096633 45766912 ~ 45767871 (-)
G1454487 LOC106572750 other downstream 3291793 45518826 ~ 45572711 (-)
G1454346 NA other downstream 3641432 45222779 ~ 45223072 (-)
LOC110493937 LOC106565242 other downstream 4109339 44752248 ~ 44755352 (-)
G1459296 NA other upstream 796186 49661551 ~ 49661921 (-)
G1459333 LOC106584726 other upstream 861987 49727352 ~ 49766069 (-)
LOC110494969 LOC106584726 other upstream 1091149 49953456 ~ 49964331 (-)
G1459325 LOC106565145 other upstream 1126198 49991563 ~ 50035512 (-)
LOC118940151 NA other upstream 1308943 50173658 ~ 50178053 (-)

Expression

G1458499 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G1458499 Expression in each Bioproject

Bar chart with 19 bars.
G1458499 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 300.
End of interactive chart.

Co-expression Network