G1458301


Basic Information

Item Value
gene id G1458301
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information

Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 49209950 ~ 49269648 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence

>TU1668399
agagcagttggaggccacggaaatcaaatcaaatcaaatcaaattgtatttgtcacatacacatggttagcagatgttaatgcgagtgtagcgaaatgcttgtgcttctagttccgacaatgcagtaataaccaacaagtaatctaactaacaattccaaaactactgtcttgtacacagtgtaaggggataaagaatatgtacataaggatatatgaatgagtgatggtacagagcagcataggcaagatacagtag

Function

NR:

description
LOW QUALITY PROTEIN: transcription and mRNA export factor ENY2-like

GO: NA

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
TU1668399 True 258 lncRNA 0.38 2 49209950 49269648

Neighbor

gene id symbol gene type direction distance location
LOC110494028 LOC106565296 coding upstream 89533 48977901 ~ 49120417 (+)
LOC118940474 NA coding upstream 174026 49033962 ~ 49035924 (+)
LOC118940102 NA coding upstream 229383 48977636 ~ 48980567 (+)
erc2 LOC106583361 coding upstream 271929 48866589 ~ 49040356 (+)
bsnb LOC106565168 coding upstream 396727 48693321 ~ 48814670 (+)
LOC110494034 LOC106565158 coding downstream 39504 49309152 ~ 49319617 (+)
cacna1da LOC106583449 coding downstream 209268 49478916 ~ 49594500 (+)
LOC110494954 LOC106565153 coding downstream 335015 49604663 ~ 49657967 (+)
LOC110494957 qrich1 coding downstream 911397 50181045 ~ 50192699 (+)
LOC110494976 LOC106565138 coding downstream 927455 50197103 ~ 50207320 (+)
G1458293 NA non-coding upstream 26209 49181902 ~ 49183741 (+)
G1458265 NA non-coding upstream 41083 49146507 ~ 49168867 (+)
G1458264 NA non-coding upstream 67302 49142070 ~ 49142648 (+)
G1458237 NA non-coding upstream 126297 49068027 ~ 49083653 (+)
G1458226 NA non-coding upstream 189270 49019387 ~ 49020680 (+)
G1458725 NA non-coding downstream 61087 49330735 ~ 49332979 (+)
G1458811 NA non-coding downstream 175160 49444808 ~ 49445154 (+)
G1458919 NA non-coding downstream 196196 49465844 ~ 49466045 (+)
G1458927 NA non-coding downstream 199633 49469281 ~ 49469561 (+)
G1458931 NA non-coding downstream 201266 49470914 ~ 49471432 (+)
LOC110494013 LOC106565177 other upstream 785545 48389082 ~ 48424478 (+)
glrx LOC106565191 other upstream 1173367 48030892 ~ 48036585 (+)
G1456969 NA other upstream 1370580 47833580 ~ 47839370 (+)
G1458807 NA other downstream 169358 49439006 ~ 49439329 (+)
atxn7l2a LOC106565127 other downstream 1161159 50427145 ~ 50437612 (+)
G1459769 NA other downstream 1506881 50776529 ~ 50777072 (+)
LOC110494047 btg2 other downstream 1625292 50894903 ~ 50897444 (+)

Expression


Co-expression Network