G1460034



Basic Information


Item Value
gene id G1460034
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 50555031 ~ 50562145 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1670400
cccattcctccttgcaaaacagctcgagctcagtgaggttggatggagagcatttgtgaacagcagttttcagttctttccacagattctcgattggattcaggtctggactttgacttggccattctaacacctggatatgtttatttttgaaccattccattgtagatgttgctttatgttttggatcattgtcttgttggaagacaaatctctgtcccagtctcaggtcttttgcagactccatcaggttttcttccagaatggtcctgtatttggctccatccatcttcccatcaattttaaccatcttccctgtccctgct

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1670400 True 326 lncRNA 0.43 2 50555031 50562145

Neighbor


gene id symbol gene type direction distance location
LOC110494987 LOC106565122 coding downstream 47170 50506645 ~ 50507861 (-)
usp48 LOC106565123 coding downstream 71098 50459542 ~ 50483933 (-)
zbtb40 zbtb40 coding downstream 99301 50445805 ~ 50455730 (-)
fbxo42 LOC106565130 coding downstream 174626 50364407 ~ 50380405 (-)
slc25a34 LOC106565132 coding downstream 191947 50349819 ~ 50363084 (-)
LOC110494983 rl10a coding upstream 15870 50578015 ~ 50580624 (-)
LOC110494977 LOC100136526 coding upstream 28302 50590447 ~ 50629054 (-)
LOC110494964 LOC106565117 coding upstream 67826 50629971 ~ 50650254 (-)
LOC110494038 stk38 coding upstream 146790 50708935 ~ 50727747 (-)
LOC110495176 NA coding upstream 187143 50749288 ~ 50752089 (-)
G1459995 NA non-coding downstream 62821 50491912 ~ 50492210 (-)
G1459963 NA non-coding downstream 129628 50425170 ~ 50425403 (-)
G1459953 NA non-coding downstream 150580 50404180 ~ 50404451 (-)
G1459952 NA non-coding downstream 150992 50403543 ~ 50404039 (-)
G1459944 NA non-coding downstream 162205 50392600 ~ 50392826 (-)
G1460039 NA non-coding upstream 12450 50574595 ~ 50574882 (-)
G1460040 NA non-coding upstream 12781 50574926 ~ 50575127 (-)
G1460106 NA non-coding upstream 126154 50688299 ~ 50688700 (-)
G1460128 NA non-coding upstream 192789 50754934 ~ 50760996 (-)
G1460132 NA non-coding upstream 197523 50759668 ~ 50760383 (-)
LOC118940151 NA other downstream 380438 50173658 ~ 50178053 (-)
G1459325 LOC106565145 other downstream 519519 49991563 ~ 50035512 (-)
LOC110494969 LOC106584726 other downstream 596768 49953456 ~ 49964331 (-)
G1459333 LOC106584726 other downstream 788962 49727352 ~ 49766069 (-)
LOC110494046 LOC106565111 other upstream 305082 50862652 ~ 50875481 (-)
G1460539 NA other upstream 436609 50998754 ~ 50999404 (-)
LOC110494054 LOC106565105 other upstream 501099 51063244 ~ 51077345 (-)
G1461521 NA other upstream 1184771 51746916 ~ 51761022 (-)

Expression


G1460034 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 60.
End of interactive chart.

G1460034 Expression in each Bioproject

Bar chart with 16 bars.
G1460034 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network