G1460134



Basic Information


Item Value
gene id G1460134
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 50763420 ~ 50763802 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1670509
gaaacatccctttttcaggaccctgtctttcaaagataatttgtaaaaatccaaataacttcacagatcttcattgtaaagggtttaaacactgtttcccatgcttgttcaatgaaccataaacaattaatgaacatgcacctgtggaacggttgttaagacactaacagcttacagacggtaggcaattaaggtcacagttatgaaaacttaggacactaaagaggcctttctactgactctgaaaaacaccaaaagaaacatacccagggtccctgctcatctgcgtgaacgtgccttagggatgctgcaaggaggcatgaggactgcagatgtgtccagggcaataaattgcaatgtctgtactgtgagacgcctaagac

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1670509 True 383 lncRNA 0.42 1 50763420 50763802
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110495176 NA coding downstream 11331 50749288 ~ 50752089 (-)
LOC110494038 stk38 coding downstream 35673 50708935 ~ 50727747 (-)
LOC110494964 LOC106565117 coding downstream 113166 50629971 ~ 50650254 (-)
LOC110494977 LOC100136526 coding downstream 134366 50590447 ~ 50629054 (-)
LOC110494983 rl10a coding downstream 182796 50578015 ~ 50580624 (-)
LOC118936271 LOC106565115 coding upstream 14792 50778594 ~ 50810704 (-)
LOC110494045 LOC106565112 coding upstream 77543 50841345 ~ 50852502 (-)
LOC110494046 LOC106565111 coding upstream 98850 50862652 ~ 50875481 (-)
LOC110493205 NA coding upstream 150723 50914525 ~ 50927415 (-)
c17h6orf89 LOC106565108 coding upstream 166571 50930373 ~ 50941234 (-)
G1460133 NA non-coding downstream 547 50762598 ~ 50762873 (-)
G1460132 NA non-coding downstream 3037 50759668 ~ 50760383 (-)
G1460128 NA non-coding downstream 3423 50754934 ~ 50760996 (-)
G1460106 NA non-coding downstream 74720 50688299 ~ 50688700 (-)
G1460040 NA non-coding downstream 188293 50574926 ~ 50575127 (-)
G1460156 NA non-coding upstream 50899 50814701 ~ 50815057 (-)
G1460158 NA non-coding upstream 55702 50819504 ~ 50821110 (-)
G1460163 NA non-coding upstream 69643 50833445 ~ 50833757 (-)
G1460492 NA non-coding upstream 135578 50899380 ~ 50899597 (-)
G1460497 NA non-coding upstream 141908 50905710 ~ 50905910 (-)
slc25a34 LOC106565132 other downstream 408670 50349819 ~ 50363084 (-)
LOC118940151 NA other downstream 588827 50173658 ~ 50178053 (-)
G1459325 LOC106565145 other downstream 727908 49991563 ~ 50035512 (-)
LOC110494969 LOC106584726 other downstream 805157 49953456 ~ 49964331 (-)
G1460539 NA other upstream 234952 50998754 ~ 50999404 (-)
LOC110494054 LOC106565105 other upstream 299442 51063244 ~ 51077345 (-)
G1461521 NA other upstream 983114 51746916 ~ 51761022 (-)
G1462356 NA other upstream 1940331 52704133 ~ 52704688 (-)

Expression


G1460134 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 100.
End of interactive chart.

G1460134 Expression in each Bioproject

Bar chart with 21 bars.
G1460134 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 4000.
End of interactive chart.

Co-expression Network