G1460176



Basic Information


Item Value
gene id G1460176
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 50885547 ~ 50885768 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1670560
cattatattaggtagcattgtttaaagtggctagtgctatattttacatcatttcccatcaattcccattattaaagtggctggagttgagtcagtgtgttggcagcagccactcaatgttagtggtggctgtttaacagtctgatggccttgagatagaagctgtttttcagtctctcggtcccagctttgatgcacctgtactgacctcgctttctggat

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1670560 True 222 lncRNA 0.43 1 50885547 50885768
Loading

Neighbor


gene id symbol gene type direction distance location
rbbp5 LOC106565113 coding upstream 24449 50852607 ~ 50861098 (+)
LOC110494043 LOC106565114 coding upstream 45143 50837015 ~ 50840404 (+)
LOC110493204 NA coding upstream 56348 50825463 ~ 50829199 (+)
LOC118936400 NA coding upstream 66495 50816422 ~ 50819052 (+)
dram2b tmm77 coding upstream 126802 50753871 ~ 50758745 (+)
LOC110494047 btg2 coding downstream 9135 50894903 ~ 50897444 (+)
apobec2a LOC100196684 coding downstream 166914 51052682 ~ 51062761 (+)
csf1 csf1 coding downstream 715665 51601433 ~ 51640412 (+)
LOC110494059 nfasc coding downstream 1081271 51967039 ~ 52121978 (+)
LOC110494060 LOC106565094 coding downstream 1304831 52190599 ~ 52273991 (+)
G1459816 LOC106565111 non-coding upstream 18387 50866886 ~ 50867160 (+)
G1459815 LOC106565111 non-coding upstream 18862 50862668 ~ 50866685 (+)
G1459797 NA non-coding upstream 69665 50815657 ~ 50815882 (+)
G1459795 NA non-coding upstream 70509 50814713 ~ 50815038 (+)
G1459793 NA non-coding upstream 72821 50812504 ~ 50812726 (+)
G1460177 NA non-coding downstream 457 50886225 ~ 50886556 (+)
G1460190 NA non-coding downstream 20975 50906743 ~ 50906946 (+)
G1460205 NA non-coding downstream 41784 50927552 ~ 50928158 (+)
G1460203 NA non-coding downstream 44270 50930038 ~ 50931328 (+)
G1460202 NA non-coding downstream 45674 50931442 ~ 50933523 (+)
G1459769 NA other upstream 108475 50776529 ~ 50777072 (+)
atxn7l2a LOC106565127 other upstream 449841 50427145 ~ 50437612 (+)
LOC110494957 qrich1 other upstream 701851 50181045 ~ 50192699 (+)
G1458807 NA other upstream 1446218 49439006 ~ 49439329 (+)
erc2 LOC106583361 other upstream 1845191 48866589 ~ 49040356 (+)
G1460249 LOC106565103 other downstream 194364 51080132 ~ 51137770 (+)
G1464092 LOC106565344 other downstream 3288246 54147039 ~ 54189617 (+)
LOC110494100 LOC106565348 other downstream 3370613 54256327 ~ 54264616 (+)
LOC110494110 LOC106565356 other downstream 3585937 54471705 ~ 54474472 (+)

Expression


G1460176 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 30.
End of interactive chart.

G1460176 Expression in each Bioproject

Bar chart with 20 bars.
G1460176 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 750.
End of interactive chart.

Co-expression Network