G1464954



Basic Information


Item Value
gene id G1464954
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 54726796 ~ 54727895 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1675710
tggagagagttgaatatacagtgccttgcgaaattattcggcccccttgaactttgcgaccttttgccacatttcaggcttcaaacataaaggtataaaactgtatttctttgtgaagaatcaacaacaagtgggacacaatcatagagtggaacgacatttattggataattcaaacttttttaacaaatcaaaaactgaaaaattgggcgtgcaaaattattcagcccctttactttcagtgcagcaaactctctccagaagttcagtgaggatctctgaatgatccaatgttgacctaaatgactgatgatgataaatacaatccacctgtgtgtaatcaagtctccgtataaatgcacctgcactgtgatagtctcagaggtccgttaaaagcgcagagagcatcatgaagaacaaggaacacaccaggcaggtccgagatactgttgtgaagaagtttaaagccagatttggatacaaaaagatttcccaagctttaaacatcccaaggagcactttgcaagcgataatattgaaatggaaggagtatcagaccactgcaaatctaccaagacctggccgtccctctaaactttcagctcatgcaaggagaagactgatcagagatgcagccaagaggcccatgatcactctggatgaactgcagagatctacagctgaggtgggagactctgtccataggacaacaatcagtcgtatattgcacaaatctggcctatatggaagagtggcaagaagaaagccatttcttaaagatatccataaaaagtgttgtttaaagtttgccacaagccacctgggagacacaccaaacatgtggaagaaggtgctctggtcagatgaaaccaaaattgaactttttggcaaccatgcaaaacattatgtttggcgtaaaagcaacacagctcatcaccctgaacaccctatccccactgtcaaacatggtggtggcagcatcatggtttgggcctgcttttcttcagcagggacagggaagatggttaaaattgatgggaagatggatggagccaaatacaggaccattctggaagaaaacctgatggagtctgcaaaag

Function


NR:

description
Tc1-like transporase

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1675710 True 1100 TUCP 0.42 1 54726796 54727895
Loading

Neighbor


gene id symbol gene type direction distance location
c17h1orf159 cssa12h1orf159 coding downstream 22395 54698441 ~ 54704401 (-)
LOC110494135 rnf223 coding downstream 31310 54693191 ~ 54695486 (-)
si:ch211-157b11.14 perm1 coding downstream 35829 54676125 ~ 54690967 (-)
ppil1 LOC106565501 coding downstream 92414 54633082 ~ 54634382 (-)
tspo LOC100136652 coding downstream 247151 54473949 ~ 54479645 (-)
LOC110494132 LOC106583563 coding upstream 15630 54743525 ~ 54759271 (-)
LOC110494115 LOC106565367 coding upstream 34589 54762484 ~ 54777445 (-)
celf4 LOC106565371 coding upstream 138196 54866028 ~ 54973879 (-)
LOC110493219 LOC106565506 coding upstream 894019 55621914 ~ 55625468 (-)
LOC110494120 LOC106565379 coding upstream 1097637 55825532 ~ 55880570 (-)
G1464948 NA non-coding downstream 12146 54714409 ~ 54714650 (-)
G1464947 NA non-coding downstream 12773 54713776 ~ 54714023 (-)
G1464945 NA non-coding downstream 19973 54706286 ~ 54706823 (-)
G1464896 LOC106565361 non-coding downstream 62920 54658294 ~ 54663876 (-)
G1464925 NA non-coding downstream 76296 54650270 ~ 54650500 (-)
G1465001 NA non-coding upstream 75633 54803528 ~ 54819314 (-)
G1465119 NA non-coding upstream 261168 54989063 ~ 54989335 (-)
G1465163 NA non-coding upstream 289099 55016994 ~ 55017366 (-)
G1465187 NA non-coding upstream 304419 55032314 ~ 55032744 (-)
G1464950 ccdc36 other downstream 9306 54716104 ~ 54717490 (-)
G1464933 NA other downstream 52877 54672252 ~ 54673919 (-)
G1464551 NA other downstream 263094 54462671 ~ 54463702 (-)
G1463760 NA other downstream 946300 53778482 ~ 53780496 (-)
G1462356 NA other downstream 2022108 52704133 ~ 52704688 (-)
LOC110494137 LOC106565384 other upstream 1226578 55954473 ~ 55971001 (-)
dnai1.2 dnai1 other upstream 1434965 56130667 ~ 56167366 (-)
elmo2 LOC106565399 other upstream 1766961 56494856 ~ 56530610 (-)
hig1a hig1a other upstream 2501612 57229440 ~ 57233433 (-)
G1470802 NA other upstream 4946646 59674541 ~ 59676694 (-)

Expression


G1464954 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G1464954 Expression in each Bioproject

Bar chart with 19 bars.
G1464954 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 200.
End of interactive chart.

Co-expression Network