G1465163



Basic Information


Item Value
gene id G1465163
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 55016994 ~ 55017366 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1675947
ggagctttctagccacgttcaacatgtcaagcaggtcctgcagcggttattggagaaccgtctgttcgtgaaggctgagaagtgtgatttttcacgcccacacgacgtccttcctcggttacatcatctccaggggagagatcaagatggaccaagagaaggttcgggcggttcgggattgggtccagcccggttcgagattgcagctccagagattcctggggtttgcaaatttttatcggaggtttatccgtgattacagccgggtggccgcccctttaactgtactgacgtcttgcaccagaaagttctgttggtctcctgaggcagaccgagcatttctagatttgaagagccgattcaccaacgcccc

Function


NR:

description
Pol polyprotein

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1675947 True 373 lncRNA 0.53 1 55016994 55017366

Neighbor


gene id symbol gene type direction distance location
celf4 LOC106565371 coding downstream 43115 54866028 ~ 54973879 (-)
LOC110494115 LOC106565367 coding downstream 239549 54762484 ~ 54777445 (-)
LOC110494132 LOC106583563 coding downstream 257723 54743525 ~ 54759271 (-)
kbtbd12 LOC106565366 coding downstream 281055 54717983 ~ 54735939 (-)
c17h1orf159 cssa12h1orf159 coding downstream 312593 54698441 ~ 54704401 (-)
LOC110493219 LOC106565506 coding upstream 604548 55621914 ~ 55625468 (-)
LOC110494120 LOC106565379 coding upstream 808166 55825532 ~ 55880570 (-)
LOC110494118 LOC106565381 coding upstream 867507 55884873 ~ 55925710 (-)
LOC110494121 LOC106565382 coding upstream 908672 55926038 ~ 55933411 (-)
LOC110494137 LOC106565384 coding upstream 938938 55954473 ~ 55971001 (-)
G1465119 NA non-coding downstream 27659 54989063 ~ 54989335 (-)
G1465001 NA non-coding downstream 197680 54803528 ~ 54819314 (-)
G1464948 NA non-coding downstream 302344 54714409 ~ 54714650 (-)
G1464947 NA non-coding downstream 302971 54713776 ~ 54714023 (-)
G1465187 NA non-coding upstream 14948 55032314 ~ 55032744 (-)
G1465189 NA non-coding upstream 16100 55033466 ~ 55033691 (-)
G1465208 NA non-coding upstream 32750 55050116 ~ 55050331 (-)
G1465239 NA non-coding upstream 57315 55074681 ~ 55074920 (-)
G1465259 NA non-coding upstream 73878 55091244 ~ 55091456 (-)
G1464954 NA other downstream 289099 54726796 ~ 54727895 (-)
G1464950 ccdc36 other downstream 299504 54716104 ~ 54717490 (-)
G1464933 NA other downstream 343075 54672252 ~ 54673919 (-)
G1464551 NA other downstream 553292 54462671 ~ 54463702 (-)
G1463760 NA other downstream 1236498 53778482 ~ 53780496 (-)
dnai1.2 dnai1 other upstream 1145494 56130667 ~ 56167366 (-)
elmo2 LOC106565399 other upstream 1477490 56494856 ~ 56530610 (-)
hig1a hig1a other upstream 2212141 57229440 ~ 57233433 (-)
G1470802 NA other upstream 4657175 59674541 ~ 59676694 (-)

Expression


G1465163 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 3.
End of interactive chart.

G1465163 Expression in each Bioproject

Bar chart with 13 bars.
G1465163 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network