G1467830



Basic Information


Item Value
gene id G1467830
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 57173548 ~ 57173797 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1678899
accgtgacagaatcacccaccacaacaggaccaagcggcgtggtaacgggcaacagcaacagcggcgcaaagaggaatggacatgggacgatgtattggacggcaagggttgctacacctgggaggagatcctggcgggaaaggatcgccttccatgggaacaggtggaggcagctaggagagcagaggcagccggagagaggagccggcgatatgagggaacacggctggcaaggaagcccgagaggca

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1678899 True 250 lncRNA 0.60 1 57173548 57173797
Loading

Neighbor


gene id symbol gene type direction distance location
stx16 LOC106565427 coding downstream 28252 57132997 ~ 57145296 (-)
LOC110493226 npepl1 coding downstream 50841 57121443 ~ 57122707 (-)
cathy cathy coding downstream 56838 57113006 ~ 57116710 (-)
olfml3b olfml3 coding downstream 200916 56966942 ~ 56972632 (-)
LOC110493224 LOC106565414 coding downstream 252774 56900273 ~ 56920774 (-)
hig1a hig1a coding upstream 55643 57229440 ~ 57233433 (-)
LOC118940479 NA coding upstream 120439 57294236 ~ 57308483 (-)
LOC110494192 LOC106565510 coding upstream 156324 57330121 ~ 57332994 (-)
LOC110494193 LOC106565432 coding upstream 183581 57357378 ~ 57460651 (-)
si:ch1073-456m8.1 LOC106565433 coding upstream 306667 57480464 ~ 57492399 (-)
G1467823 NA non-coding downstream 11662 57161650 ~ 57161886 (-)
G1467816 NA non-coding downstream 24836 57147311 ~ 57148712 (-)
G1467714 NA non-coding downstream 61574 57111128 ~ 57111974 (-)
G1467785 NA non-coding downstream 144573 57028504 ~ 57028975 (-)
LOC110494175 LOC106583348 non-coding downstream 300567 56827756 ~ 56883416 (-)
G1467831 NA non-coding upstream 711 57174508 ~ 57174798 (-)
G1467898 NA non-coding upstream 132045 57305842 ~ 57310683 (-)
G1467896 LOC100196653 non-coding upstream 151701 57325498 ~ 57329426 (-)
G1467934 NA non-coding upstream 160477 57334274 ~ 57334615 (-)
G1467936 NA non-coding upstream 165506 57339303 ~ 57340561 (-)
elmo2 LOC106565399 other downstream 673223 56494856 ~ 56530610 (-)
dnai1.2 dnai1 other downstream 1006211 56130667 ~ 56167366 (-)
LOC110494137 LOC106565384 other downstream 1202834 55954473 ~ 55971001 (-)
G1464954 NA other downstream 2445653 54726796 ~ 54727895 (-)
G1464950 ccdc36 other downstream 2456058 54716104 ~ 54717490 (-)
G1470802 NA other upstream 2500744 59674541 ~ 59676694 (-)
LOC110494253 LOC106565590 other upstream 2817178 59990975 ~ 59999740 (-)
LOC110494257 LOC106565586 other upstream 2932872 60104033 ~ 60110249 (-)
G1471219 srgap3 other upstream 3201949 60375633 ~ 60376864 (-)

Expression


G1467830 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 200.
End of interactive chart.

G1467830 Expression in each Bioproject

Bar chart with 17 bars.
G1467830 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 1500.
End of interactive chart.

Co-expression Network