G1470824



Basic Information


Item Value
gene id G1470824
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 59706044 ~ 59706297 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1682247
tctgatactccttccatttcaatattatcgcttgcacagtgctccttgggatgtttatgtatccaaatccggctttaaacttcttcacaacagtatctcggacctgcctggtgtgttccttgttcttcatgatgctctctgtgcttttaacggacctctgagactatcacaatgcaggtgcatttatacggagacttgattacacacaggtggattgtatttatcatcattagtcatttaggtcaacattggat

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1682247 True 254 lncRNA 0.41 1 59706044 59706297
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110494248 LOC106565478 coding downstream 214506 59478400 ~ 59491538 (-)
sumf1 sumf1 coding downstream 423470 59268238 ~ 59282574 (-)
LOC118940103 NA coding downstream 610990 59093589 ~ 59095054 (-)
LOC110494243 LOC106565512 coding downstream 613563 59087339 ~ 59092481 (-)
LOC110494242 zc3h10 coding downstream 628438 59071949 ~ 59077606 (-)
LOC110493229 LOC106565594 coding upstream 4040 59710337 ~ 59832535 (-)
atf1 LOC106565593 coding upstream 172022 59878319 ~ 59905189 (-)
LOC110493230 LOC106565592 coding upstream 205237 59911534 ~ 59990825 (-)
LOC110494253 LOC106565590 coding upstream 285223 59990975 ~ 59999740 (-)
LOC110494254 LOC106565589 coding upstream 301707 60008004 ~ 60028651 (-)
G1470805 NA non-coding downstream 25072 59680752 ~ 59680972 (-)
G1470350 NA non-coding downstream 50375 59655458 ~ 59655669 (-)
G1470314 NA non-coding downstream 79286 59626516 ~ 59626758 (-)
G1470310 NA non-coding downstream 81711 59623932 ~ 59624333 (-)
G1470300 NA non-coding downstream 92163 59612856 ~ 59613881 (-)
G1470934 NA non-coding upstream 199432 59905729 ~ 59910291 (-)
G1470937 NA non-coding upstream 204109 59910406 ~ 59911445 (-)
G1470932 NA non-coding upstream 296345 60002642 ~ 60004577 (-)
G1470998 NA non-coding upstream 323829 60030126 ~ 60030325 (-)
G1471009 NA non-coding upstream 344013 60050310 ~ 60050549 (-)
G1470802 NA other downstream 29350 59674541 ~ 59676694 (-)
hig1a hig1a other downstream 2473337 57229440 ~ 57233433 (-)
elmo2 LOC106565399 other downstream 3205719 56494856 ~ 56530610 (-)
dnai1.2 dnai1 other downstream 3538707 56130667 ~ 56167366 (-)
LOC110494137 LOC106565384 other downstream 3735330 55954473 ~ 55971001 (-)
LOC110494257 LOC106565586 other upstream 400372 60104033 ~ 60110249 (-)
G1471219 srgap3 other upstream 669449 60375633 ~ 60376864 (-)
G1471564 NA other upstream 931883 60638180 ~ 60639335 (-)
ccdc174 NA other upstream 2540082 62246379 ~ 62250654 (-)

Expression


G1470824 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G1470824 Expression in each Bioproject

Bar chart with 16 bars.
G1470824 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network