G1473981



Basic Information


Item Value
gene id G1473981
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 62897156 ~ 62897547 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1685704
cctttacatggatcagtcgtcctggtccctttgcagaaaaacagcctcaaagcatgatgtttccacccccatgcttcacagtaggtatggtgttctttggatgcaactcagcattctttgtcctctaaacacgacgagttgagtttttaccaaaaagttatattttggtttcatctgaccatatgacattctcccaaccttcttctggatcatccaaatgctctctagcaaacttcagacgggcctggacatgtactggcttaagcaggggacacgtctggcactgcaggatttgagtccctggtggcgtagtgtgttactgatggtaggctttgttactttggtcccagctctctgcaggtcattcactaggtccccgcgtgtggttctgg

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1685704 True 392 lncRNA 0.48 1 62897156 62897547
Loading

Neighbor


gene id symbol gene type direction distance location
stat2 stat2 coding upstream 57236 62826568 ~ 62839920 (+)
LOC110494322 LOC106565525 coding upstream 84932 62807657 ~ 62812224 (+)
c1galt1b LOC106565526 coding upstream 122715 62763482 ~ 62774441 (+)
LOC110493236 LOC106583228 coding upstream 136991 62747771 ~ 62760165 (+)
LOC110494319 LOC106565529 coding upstream 247631 62575985 ~ 62649525 (+)
tsfm LOC106565519 coding downstream 59177 62956724 ~ 62958969 (+)
myl6 LOC106565518 coding downstream 62542 62960089 ~ 62968544 (+)
pfkmb LOC106565515 coding downstream 207048 63104595 ~ 63121550 (+)
itgb7 LOC106583060 coding downstream 227341 63124888 ~ 63141041 (+)
espl1 espl1 coding downstream 261516 63159063 ~ 63188421 (+)
G1473967 NA non-coding upstream 14906 62882023 ~ 62882250 (+)
G1473960 NA non-coding upstream 28901 62867827 ~ 62868255 (+)
G1473957 NA non-coding upstream 36701 62860162 ~ 62860455 (+)
G1473911 NA non-coding upstream 69939 62826785 ~ 62827217 (+)
G1473953 NA non-coding upstream 74386 62822556 ~ 62822770 (+)
G1473985 NA non-coding downstream 7345 62904892 ~ 62905356 (+)
G1473992 NA non-coding downstream 22134 62919681 ~ 62919914 (+)
G1474003 NA non-coding downstream 39737 62937284 ~ 62939881 (+)
G1474022 NA non-coding downstream 73984 62971531 ~ 62974394 (+)
G1474024 smarcc2 non-coding downstream 81853 62979400 ~ 62979798 (+)
G1473177 NA other upstream 186020 62710339 ~ 62711136 (+)
G1473171 LOC106581772 other upstream 198341 62698503 ~ 62698815 (+)
LOC110494283 LOC106565563 other upstream 1340118 61555873 ~ 61558328 (+)
G1471723 LOC100380707 other upstream 1898093 60972478 ~ 60999063 (+)
G1470607 NA other upstream 2793149 60101892 ~ 60104007 (+)
G1474159 NA other downstream 319401 63216948 ~ 63217594 (+)
srsf3b LOC106565658 other downstream 760897 63658373 ~ 63663255 (+)
tmcc2 LOC106565656 other downstream 786543 63684043 ~ 63691033 (+)
G1475820 NA other downstream 1665827 64563374 ~ 64565146 (+)
LOC110494386 LOC106565630 other downstream 1710707 64608194 ~ 64625111 (+)

Expression


G1473981 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 6.
End of interactive chart.

G1473981 Expression in each Bioproject

Bar chart with 20 bars.
G1473981 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network