G1485070



Basic Information


Item Value
gene id G1485070
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 72797895 ~ 72798215 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1698083
GGGGGTCTACCAGCCCTGCAGCTCCAAATCTCCACTGAAGCGCATACACAAAATGCCATTGTGGGGCCTTGTAACGCCACCGAACATCAGTGCTAACAGACATGGTCTTCGCCTTCCTCCAATGTGTATTTTCAATGATTATTGTAACGCACATACAATACATGAACATTATCATGGCAACTAGAATGGGTAGTTATGGCATAGGAAATGCCTTGGCATGACCTCTTGTGACCCTAAAGGGAAAGCGGTGACCTCAGACTGACCTATGTCTCATCTCCTGTTCGTCCTCTCTGATCAGGAAGAAATAAGCAGGTCTCCTAG

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1698083 True 321 lncRNA 0.47 1 72797895 72798215
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110494513 LOC106565822 coding upstream 158798 72630322 ~ 72639097 (+)
LOC110494511 LOC106565826 coding upstream 176598 72586788 ~ 72621297 (+)
LOC110494512 LOC106565824 coding upstream 185097 72601325 ~ 72612798 (+)
LOC110494510 LOC106565827 coding upstream 212737 72547152 ~ 72585158 (+)
LOC110494508 LOC106565828 coding upstream 274128 72453359 ~ 72523767 (+)
LOC110494516 LOC105017315 coding downstream 19953 72818168 ~ 72828562 (+)
LOC110494520 LOC106565815 coding downstream 64144 72862359 ~ 72864606 (+)
LOC110494525 LOC106565811 coding downstream 246131 73044346 ~ 73049958 (+)
LOC110494536 LOC106565804 coding downstream 568587 73366802 ~ 73384379 (+)
LOC110494537 LOC106565802 coding downstream 597525 73395740 ~ 73416687 (+)
G1485065 NA non-coding upstream 6948 72790071 ~ 72790947 (+)
G1485006 NA non-coding upstream 104418 72689644 ~ 72693477 (+)
G1484985 NA non-coding upstream 122228 72660006 ~ 72675667 (+)
G1484943 NA non-coding upstream 253452 72544161 ~ 72544443 (+)
G1484896 NA non-coding upstream 343739 72453953 ~ 72454156 (+)
G1485023 LOC106565817 non-coding downstream 48654 72846869 ~ 72852122 (+)
G1485196 NA non-coding downstream 224900 73023115 ~ 73036053 (+)
G1485233 NA non-coding downstream 289487 73087702 ~ 73087929 (+)
G1485238 NA non-coding downstream 296369 73094584 ~ 73094800 (+)
G1485257 NA non-coding downstream 321172 73119387 ~ 73119600 (+)
G1484897 NA other upstream 342971 72454563 ~ 72454924 (+)
G1484782 NA other upstream 492483 72304723 ~ 72305412 (+)
G1483638 NA other upstream 1415623 71381944 ~ 71382272 (+)
G1483346 LOC106565841 other upstream 1617466 71178513 ~ 71180429 (+)
LOC110494494 atxn7 other upstream 1956665 70809971 ~ 70847390 (+)
G1485260 NA other downstream 324611 73122826 ~ 73125356 (+)
G1485819 NA other downstream 483045 73281260 ~ 73282019 (+)
G1486811 NA other downstream 1180675 73978890 ~ 73979435 (+)
LOC110493252 LOC106565788 other downstream 1590321 74388428 ~ 74432420 (+)

Expression


G1485070 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 0.8.
End of interactive chart.

G1485070 Expression in each Bioproject

Bar chart with 8 bars.
G1485070 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 6.
End of interactive chart.

Co-expression Network