G1485783



Basic Information


Item Value
gene id G1485783
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 73243078 ~ 73248917 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1698885
ggctagagcaaggcccgcctccaaccctccgaccagtcaagaagaccgaaacgacaagactccacctactttattatatgtataaaaatgaatgtaaccgttgtataggctctctttttcacctggctccttgccgagttatgtgaactaggtccgtgcacgtaaaactgcgggacaagatatctcagactcattaaaactgtcttttgttacaactgaaa

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1698885 True 221 lncRNA 0.44 2 73243078 73248917

Neighbor


gene id symbol gene type direction distance location
LOC110494525 LOC106565811 coding upstream 193120 73044346 ~ 73049958 (+)
LOC110494520 LOC106565815 coding upstream 378472 72862359 ~ 72864606 (+)
LOC110494516 LOC105017315 coding upstream 414516 72818168 ~ 72828562 (+)
LOC110494513 LOC106565822 coding upstream 603981 72630322 ~ 72639097 (+)
LOC110494512 LOC106565824 coding upstream 630280 72601325 ~ 72612798 (+)
LOC110494536 LOC106565804 coding downstream 117885 73366802 ~ 73384379 (+)
LOC110494537 LOC106565802 coding downstream 146823 73395740 ~ 73416687 (+)
taf4a LOC106565801 coding downstream 195833 73444750 ~ 73457632 (+)
LOC110494542 LOC106565797 coding downstream 807258 74056175 ~ 74066815 (+)
LOC110494543 LOC100136421 coding downstream 821144 74070061 ~ 74084580 (+)
G1485258 NA non-coding upstream 123038 73119839 ~ 73120040 (+)
G1485257 NA non-coding upstream 123478 73119387 ~ 73119600 (+)
G1485238 NA non-coding upstream 148278 73094584 ~ 73094800 (+)
G1485233 NA non-coding upstream 155149 73087702 ~ 73087929 (+)
G1485196 NA non-coding upstream 207025 73023115 ~ 73036053 (+)
G1485801 NA non-coding downstream 13582 73262499 ~ 73263014 (+)
G1485811 NA non-coding downstream 22478 73271395 ~ 73271657 (+)
G1485815 NA non-coding downstream 25234 73274151 ~ 73274429 (+)
G1485821 NA non-coding downstream 35996 73284913 ~ 73285159 (+)
G1485827 NA non-coding downstream 45683 73294600 ~ 73294822 (+)
G1485260 NA other upstream 117722 73122826 ~ 73125356 (+)
G1484897 NA other upstream 788154 72454563 ~ 72454924 (+)
G1484782 NA other upstream 937666 72304723 ~ 72305412 (+)
G1483638 NA other upstream 1860806 71381944 ~ 71382272 (+)
G1485819 NA other downstream 32343 73281260 ~ 73282019 (+)
G1486811 NA other downstream 729973 73978890 ~ 73979435 (+)
LOC110493252 LOC106565788 other downstream 1139619 74388428 ~ 74432420 (+)
G1490016 NA other downstream 3434682 76683599 ~ 76684020 (+)
G1491886 NA other downstream 4759373 78008290 ~ 78008799 (+)

Expression


G1485783 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 1.25.
End of interactive chart.

G1485783 Expression in each Bioproject

Bar chart with 7 bars.
G1485783 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 10.
End of interactive chart.

Co-expression Network