G1486822



Basic Information


Item Value
gene id G1486822
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 73986355 ~ 73987148 (+)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1699990
tcttaactgttatgtcattcagccctcgataatctatgcaggggcgcagagacccgtccttcttcttgacaaaaaaaaaccccgctccggcgggagaggaggaggggactatggtaccggcgtcaagagctacagacaaataatcctcgagagccttacgttcgggagccgacagagagtatagtctaccccgggggggagtggttcccggaaggagatcaatactacaatcatacgaccggtgtggaggaagagaggtggccctggaccgactgaacaccgtgcgcagatcgtgatattcctccggcacccctgtcaaatcaccaggctcctcctgtgaagaagagacagaggaaacaggagggatagcagacattaaacatttcacatgacaagagacgttccaggagaggatagaattactagaccaattaatggaaggattatgacaaactagccagggatggcccaaaacaacaggtgtaaaaggtgaacgaaaaatcaaaaaagaaatggtttcgctatgattaccagaaacagtgagggttaaaggtagcgtctcacgctgaatcctggggagaggactaccatccagggcgaacaaggccgtgggctcctttaactgtctgagaggaatgtcatgttcccgagcccaggtctcgtccataaaacagccctccgccccagagtctattaaggcactgcaggaagctgacgaaccggtccagcgtagatggaccgacaaggtagtgcaggatcttgaaggagagacaggagtagtagcgctcaccagt

Function


NR:

description
Retrotransposable element Tf2 protein type 1

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1699990 True 794 lncRNA 0.51 1 73986355 73987148
Loading

Neighbor


gene id symbol gene type direction distance location
taf4a LOC106565801 coding upstream 528723 73444750 ~ 73457632 (+)
LOC110494537 LOC106565802 coding upstream 569668 73395740 ~ 73416687 (+)
LOC110494536 LOC106565804 coding upstream 601976 73366802 ~ 73384379 (+)
LOC110494525 LOC106565811 coding upstream 936397 73044346 ~ 73049958 (+)
LOC110494520 LOC106565815 coding upstream 1121749 72862359 ~ 72864606 (+)
LOC110494542 LOC106565797 coding downstream 69027 74056175 ~ 74066815 (+)
LOC110494543 LOC100136421 coding downstream 82913 74070061 ~ 74084580 (+)
LOC110494547 LOC106565793 coding downstream 164117 74151265 ~ 74184733 (+)
LOC118940492 NA coding downstream 202847 74189995 ~ 74192932 (+)
LOC110493251 LOC106565789 coding downstream 326043 74313191 ~ 74387161 (+)
G1486818 NA non-coding upstream 4413 73981654 ~ 73981942 (+)
G1486815 NA non-coding upstream 4737 73981303 ~ 73981618 (+)
G1486814 NA non-coding upstream 5087 73980363 ~ 73981268 (+)
G1486812 NA non-coding upstream 6456 73979685 ~ 73979899 (+)
G1486799 NA non-coding upstream 17905 73968194 ~ 73968450 (+)
G1486869 NA non-coding downstream 47171 74034319 ~ 74081450 (+)
G1486928 NA non-coding downstream 158304 74145452 ~ 74145667 (+)
G1486938 NA non-coding downstream 198389 74185537 ~ 74185740 (+)
G1487100 NA non-coding downstream 246812 74233960 ~ 74234247 (+)
G1487149 NA non-coding downstream 294919 74282067 ~ 74282292 (+)
G1486811 NA other upstream 6920 73978890 ~ 73979435 (+)
G1485819 NA other upstream 704336 73281260 ~ 73282019 (+)
G1485260 NA other upstream 860999 73122826 ~ 73125356 (+)
G1484897 NA other upstream 1531431 72454563 ~ 72454924 (+)
LOC110493252 LOC106565788 other downstream 401388 74388428 ~ 74432420 (+)
G1490016 NA other downstream 2696451 76683599 ~ 76684020 (+)
G1491886 NA other downstream 4021142 78008290 ~ 78008799 (+)
G1491899 NA other downstream 4031220 78018368 ~ 78019816 (+)
G1491963 NA other downstream 4201864 78189012 ~ 78190290 (+)

Expression


G1486822 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 100.
End of interactive chart.

G1486822 Expression in each Bioproject

Bar chart with 20 bars.
G1486822 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 3000.
End of interactive chart.

Co-expression Network