G1490372



Basic Information


Item Value
gene id G1490372
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 76928783 ~ 76929236 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1703933
tcatactcgtcgccaaacccactggctccatgtcatctacaagaccctgctaggtaaagtccccccttatctcagctcgctggtcaccattgcatctcccacctgtagcacacgctccagcaggtatatctctctagtcacccccaaaaccaattatttctttggccgcctctccttccagttctctgctgccaatgactggaacgaactacaaaaatctctgaaacttgaaacacttatctccctcactagctttaagcaccaactgtcagagcagctcacagattactgcacctgtacatagcccacctataatttagcccaaacaactacctctttccctactgtatttaattaatttatttattttgctcctttgcacccccattatttttatttctactttgcacattctcccattgcaaatctaccattccagtgttttacttgctat

Function


NR:

description
unnamed protein product

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1703933 True 454 lncRNA 0.44 1 76928783 76929236

Neighbor


gene id symbol gene type direction distance location
LOC110494603 LOC106582849 coding downstream 92920 76698772 ~ 76835863 (-)
LOC110494599 LOC106565733 coding downstream 356756 76545230 ~ 76572027 (-)
LOC110493258 NA coding downstream 461180 76464920 ~ 76467603 (-)
LOC110494597 LOC106565735 coding downstream 499610 76425342 ~ 76429173 (-)
LOC110494596 LOC106565737 coding downstream 511335 76184376 ~ 76417448 (-)
LOC110494605 LOC106565730 coding upstream 79003 77008239 ~ 77087427 (-)
LOC110494609 LOC105017386 coding upstream 842165 77771401 ~ 77956458 (-)
LOC110494610 NA coding upstream 1046053 77975289 ~ 77976652 (-)
LOC110495194 NA coding upstream 1054167 77983403 ~ 77984480 (-)
LOC118940494 NA coding upstream 1060664 77989900 ~ 77990977 (-)
G1490354 NA non-coding downstream 13521 76915035 ~ 76915262 (-)
G1490338 NA non-coding downstream 26849 76901501 ~ 76901934 (-)
G1490326 NA non-coding downstream 38914 76889556 ~ 76889869 (-)
G1490319 NA non-coding downstream 47784 76880694 ~ 76880999 (-)
G1490382 NA non-coding upstream 7630 76936866 ~ 76937071 (-)
G1490401 NA non-coding upstream 23736 76952972 ~ 76953172 (-)
G1490572 NA non-coding upstream 74568 77003804 ~ 77005581 (-)
G1490630 NA non-coding upstream 177058 77106294 ~ 77106761 (-)
G1490147 NA other downstream 230687 76696796 ~ 76698096 (-)
G1488708 NA other downstream 1403187 75525182 ~ 75525596 (-)
G1488266 NA other downstream 1664560 75263720 ~ 75264223 (-)
G1487872 NA other downstream 2029036 74899391 ~ 74899747 (-)
G1487599 NA other downstream 2221174 74707345 ~ 74707609 (-)
G1491128 NA other upstream 552705 77481941 ~ 77482389 (-)
LOC110493260 NA other upstream 1158367 78086079 ~ 78088852 (-)
LOC110494620 LOC106565713 other upstream 1285763 78214999 ~ 78389849 (-)
G1492729 NA other upstream 1543782 78473018 ~ 78475506 (-)
G1492897 NA other upstream 1841504 78770740 ~ 78771954 (-)

Expression


G1490372 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G1490372 Expression in each Bioproject

Bar chart with 20 bars.
G1490372 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network