G1490630



Basic Information


Item Value
gene id G1490630
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 77106294 ~ 77106761 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1704202
ctagggctcaggtcctccgagagagagaaagagagaaggagagaattagagaacgcacacttagattcacacaggacaccgaataggacaggagaagtactccagatataacaaactgaccctagcccaccgacacataaactactgcagcataaatactggaggctgagacaggaggggtcaggagacactgtggcccactccgaggacaccccc

Function


NR:

description
unnamed protein product, partial

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1704202 True 216 lncRNA 0.52 2 77106294 77106761

Neighbor


gene id symbol gene type direction distance location
LOC110494605 LOC106565730 coding downstream 18867 77008239 ~ 77087427 (-)
LOC110494603 LOC106582849 coding downstream 270431 76698772 ~ 76835863 (-)
LOC110494599 LOC106565733 coding downstream 534267 76545230 ~ 76572027 (-)
LOC110493258 NA coding downstream 638691 76464920 ~ 76467603 (-)
LOC110494597 LOC106565735 coding downstream 677121 76425342 ~ 76429173 (-)
LOC110494609 LOC105017386 coding upstream 664640 77771401 ~ 77956458 (-)
LOC110494610 NA coding upstream 868528 77975289 ~ 77976652 (-)
LOC110495194 NA coding upstream 876642 77983403 ~ 77984480 (-)
LOC118940494 NA coding upstream 883139 77989900 ~ 77990977 (-)
LOC110494611 NA coding upstream 889973 77996734 ~ 77998924 (-)
G1490572 NA non-coding downstream 100713 77003804 ~ 77005581 (-)
G1490401 NA non-coding downstream 153122 76952972 ~ 76953172 (-)
G1490382 NA non-coding downstream 169223 76936866 ~ 76937071 (-)
G1490372 NA non-coding downstream 177058 76928783 ~ 76929236 (-)
G1490901 NA non-coding upstream 207507 77314268 ~ 77314546 (-)
G1491129 NA non-coding upstream 376139 77482900 ~ 77483182 (-)
G1491155 NA non-coding upstream 393721 77500482 ~ 77500764 (-)
G1491167 NA non-coding upstream 406761 77513522 ~ 77513864 (-)
G1491193 NA non-coding upstream 422079 77528840 ~ 77529067 (-)
G1490147 NA other downstream 408198 76696796 ~ 76698096 (-)
G1488708 NA other downstream 1580698 75525182 ~ 75525596 (-)
G1488266 NA other downstream 1842071 75263720 ~ 75264223 (-)
G1487872 NA other downstream 2206547 74899391 ~ 74899747 (-)
G1487599 NA other downstream 2398685 74707345 ~ 74707609 (-)
G1491128 NA other upstream 375180 77481941 ~ 77482389 (-)
LOC110493260 NA other upstream 980842 78086079 ~ 78088852 (-)
LOC110494620 LOC106565713 other upstream 1108238 78214999 ~ 78389849 (-)
G1492729 NA other upstream 1366257 78473018 ~ 78475506 (-)
G1492897 NA other upstream 1663979 78770740 ~ 78771954 (-)

Expression


G1490630 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G1490630 Expression in each Bioproject

Bar chart with 15 bars.
G1490630 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 100.
End of interactive chart.

Co-expression Network