G1491128



Basic Information


Item Value
gene id G1491128
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 77481941 ~ 77482389 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1704739
ctccatgctgactggcggccctggctgctccatgctgactggcggccctggctgctccatgctaactggcggctctggcggctccttgcagactggcagctctggcggctccttgcagactggcagctttggcggcatcctgcagacaggcagctctggcggctccttgcagactggcagctccttgcagactggcagctccttgcagactggcagctccttgcagactggcagctccttgcagactggcagctccttgctaactggcagctccttgctaactggcagctccttgctaactggcagctccttgcagactggcagctccatgctaactggcagctctatgctaactggcagctctatgctaactggcagttctgaacaggcgggagactccggcagcgctgtagaggcggaaagctctgacagcgctaaacaggcgggag

Function


NR:

description
PREDICTED: repetin-like

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1704739 True 449 TUCP 0.62 1 77481941 77482389
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110494605 LOC106565730 coding downstream 394514 77008239 ~ 77087427 (-)
LOC110494603 LOC106582849 coding downstream 646078 76698772 ~ 76835863 (-)
LOC110494599 LOC106565733 coding downstream 909914 76545230 ~ 76572027 (-)
LOC110493258 NA coding downstream 1014338 76464920 ~ 76467603 (-)
LOC110494597 LOC106565735 coding downstream 1052768 76425342 ~ 76429173 (-)
LOC110494609 LOC105017386 coding upstream 289012 77771401 ~ 77956458 (-)
LOC110494610 NA coding upstream 492900 77975289 ~ 77976652 (-)
LOC110495194 NA coding upstream 501014 77983403 ~ 77984480 (-)
LOC118940494 NA coding upstream 507511 77989900 ~ 77990977 (-)
LOC110494611 NA coding upstream 514345 77996734 ~ 77998924 (-)
G1490901 NA non-coding downstream 167395 77314268 ~ 77314546 (-)
G1490630 NA non-coding downstream 375180 77106294 ~ 77106761 (-)
G1490572 NA non-coding downstream 476360 77003804 ~ 77005581 (-)
G1490401 NA non-coding downstream 528769 76952972 ~ 76953172 (-)
G1491129 NA non-coding upstream 511 77482900 ~ 77483182 (-)
G1491155 NA non-coding upstream 18093 77500482 ~ 77500764 (-)
G1491167 NA non-coding upstream 31133 77513522 ~ 77513864 (-)
G1491193 NA non-coding upstream 46451 77528840 ~ 77529067 (-)
G1491201 NA non-coding upstream 49810 77532199 ~ 77532521 (-)
G1490147 NA other downstream 783845 76696796 ~ 76698096 (-)
G1488708 NA other downstream 1956345 75525182 ~ 75525596 (-)
G1488266 NA other downstream 2217718 75263720 ~ 75264223 (-)
G1487872 NA other downstream 2582194 74899391 ~ 74899747 (-)
G1487599 NA other downstream 2774332 74707345 ~ 74707609 (-)
LOC110493260 NA other upstream 605214 78086079 ~ 78088852 (-)
LOC110494620 LOC106565713 other upstream 732610 78214999 ~ 78389849 (-)
G1492729 NA other upstream 990629 78473018 ~ 78475506 (-)
G1492897 NA other upstream 1288351 78770740 ~ 78771954 (-)
G1492910 NA other upstream 1295963 78778352 ~ 78781395 (-)

Expression


G1491128 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G1491128 Expression in each Bioproject

Bar chart with 21 bars.
G1491128 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network