G1491129



Basic Information


Item Value
gene id G1491129
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 77482900 ~ 77483182 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1704740
ggagaatctggtcgactggcggatctgggagaatctggtcgactggcggatctgggagaatctggtcgactggcggatctggaagagtctggtcgactggcggatctggaagagtctggtcgactggcagatctggaagagtctggtcgactggcagatctggaagagtctggacgactggcagatctggaagagtctggacgactggcagatctggaagagtctggacgactggcagatctggaagagtctggacgactggcagatctggaagagtctggac

Function


NR:

description
PREDICTED: uncharacterized protein LOC106566445

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1704740 True 283 lncRNA 0.57 1 77482900 77483182
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110494605 LOC106565730 coding downstream 395473 77008239 ~ 77087427 (-)
LOC110494603 LOC106582849 coding downstream 647037 76698772 ~ 76835863 (-)
LOC110494599 LOC106565733 coding downstream 910873 76545230 ~ 76572027 (-)
LOC110493258 NA coding downstream 1015297 76464920 ~ 76467603 (-)
LOC110494597 LOC106565735 coding downstream 1053727 76425342 ~ 76429173 (-)
LOC110494609 LOC105017386 coding upstream 288219 77771401 ~ 77956458 (-)
LOC110494610 NA coding upstream 492107 77975289 ~ 77976652 (-)
LOC110495194 NA coding upstream 500221 77983403 ~ 77984480 (-)
LOC118940494 NA coding upstream 506718 77989900 ~ 77990977 (-)
LOC110494611 NA coding upstream 513552 77996734 ~ 77998924 (-)
G1490901 NA non-coding downstream 168354 77314268 ~ 77314546 (-)
G1490630 NA non-coding downstream 376139 77106294 ~ 77106761 (-)
G1490572 NA non-coding downstream 477319 77003804 ~ 77005581 (-)
G1490401 NA non-coding downstream 529728 76952972 ~ 76953172 (-)
G1491155 NA non-coding upstream 17300 77500482 ~ 77500764 (-)
G1491167 NA non-coding upstream 30340 77513522 ~ 77513864 (-)
G1491193 NA non-coding upstream 45658 77528840 ~ 77529067 (-)
G1491201 NA non-coding upstream 49017 77532199 ~ 77532521 (-)
G1491697 NA non-coding upstream 285935 77769117 ~ 77771137 (-)
G1491128 NA other downstream 511 77481941 ~ 77482389 (-)
G1490147 NA other downstream 784804 76696796 ~ 76698096 (-)
G1488708 NA other downstream 1957304 75525182 ~ 75525596 (-)
G1488266 NA other downstream 2218677 75263720 ~ 75264223 (-)
G1487872 NA other downstream 2583153 74899391 ~ 74899747 (-)
LOC110493260 NA other upstream 604421 78086079 ~ 78088852 (-)
LOC110494620 LOC106565713 other upstream 731817 78214999 ~ 78389849 (-)
G1492729 NA other upstream 989836 78473018 ~ 78475506 (-)
G1492897 NA other upstream 1287558 78770740 ~ 78771954 (-)
G1492910 NA other upstream 1295170 78778352 ~ 78781395 (-)

Expression


G1491129 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 8.
End of interactive chart.

G1491129 Expression in each Bioproject

Bar chart with 19 bars.
G1491129 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 150.
End of interactive chart.

Co-expression Network