G1494215



Basic Information


Item Value
gene id G1494215
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 80213833 ~ 80214046 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1708201
cgcccgtctgcccagcgccgccagtgccgcccgtctgcccagcgccgccagtgccgcccgtctgcccggagccgccaatgccgcccgtctgcccggggccgccagtgccgccagtcagccaggggccgccagtgccgccagtcagccaggggccgccagtgccgccagtcagccaggggccgccagtgccgccagtcagccaggggccgccagt

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1708201 True 214 lncRNA 0.79 1 80213833 80214046
Loading

Neighbor


gene id symbol gene type direction distance location
LOC110494673 LOC106565988 coding downstream 6726 80098447 ~ 80207107 (-)
LOC118940496 NA coding downstream 73558 80134212 ~ 80140275 (-)
LOC110494676 LOC106582761 coding downstream 123957 80047826 ~ 80089876 (-)
LOC110494667 LOC106565993 coding downstream 215585 79989673 ~ 79998248 (-)
si:ch73-15b2.5 LOC106566004 coding downstream 227668 79981942 ~ 79986165 (-)
LOC110494668 LOC106565987 coding upstream 148079 80362125 ~ 80375295 (-)
LOC110494675 LOC106565986 coding upstream 164091 80378137 ~ 80410904 (-)
trnai-uau-6 NA coding upstream 213898 80427944 ~ 80428037 (-)
trnai-uau-7 NA coding upstream 216365 80430411 ~ 80430504 (-)
trnai-uau-8 NA coding upstream 218154 80432200 ~ 80432293 (-)
G1494214 NA non-coding downstream 1558 80212024 ~ 80212275 (-)
G1494179 NA non-coding downstream 23228 80166696 ~ 80190605 (-)
G1494162 NA non-coding downstream 69517 80144022 ~ 80144316 (-)
G1494140 NA non-coding downstream 100793 80112732 ~ 80113040 (-)
G1494136 NA non-coding downstream 103790 80109813 ~ 80110043 (-)
G1494254 NA non-coding upstream 39419 80253465 ~ 80253890 (-)
G1494282 NA non-coding upstream 64001 80278047 ~ 80278417 (-)
G1494331 NA non-coding upstream 105592 80319638 ~ 80320010 (-)
G1494345 NA non-coding upstream 116767 80330813 ~ 80331057 (-)
G1494346 NA non-coding upstream 117860 80331906 ~ 80332159 (-)
G1494054 NA other downstream 126196 80071639 ~ 80087637 (-)
G1493395 LOC106582800 other downstream 864444 79348231 ~ 79349389 (-)
G1492898 NA other downstream 1398404 78771571 ~ 78815429 (-)
G1492901 NA other downstream 1399878 78803860 ~ 78813955 (-)
G1492910 NA other downstream 1432438 78778352 ~ 78781395 (-)
G1494870 NA other upstream 383948 80597994 ~ 80598532 (-)
G1494924 NA other upstream 478376 80692422 ~ 80694102 (-)
G1495003 NA other upstream 681042 80895088 ~ 80895437 (-)
G1495113 NA other upstream 851925 81065971 ~ 81066682 (-)
LOC110494689 LOC106566051 other upstream 879473 81090497 ~ 81103942 (-)

Expression


G1494215 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G1494215 Expression in each Bioproject

Bar chart with 19 bars.
G1494215 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 400.
End of interactive chart.

Co-expression Network