G1498442



Basic Information


Item Value
gene id G1498442
gene name NA
gene type unknown
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 83982341 ~ 83982894 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1712995
ccttaacccttatcttaaccattcagagttaatgcctaaccttaacccttatcttaaccattcagagttaatgcctaaccttaacccttatcttaaccattcagagttaatgccaaaccttaaccattatcgtaaccattcagagttcctgcctaaccttaacccttatcttaaccattcagagttaatgccaaaccttaacccttatcttaaccattcagagttaatgccaaaccttaacccttatcttaaccattcagagttaatgcctaaccttaacccttatcttaatcattcagagttaatgcgtaaccttaacccttatcttaaccattcagagttaatgccaaaccttaacccttatcttaaccattcagagttaatgccaaaccttaacccttatcttaaccattcagagttaatgcctaaccttaacccttatcttaaccattcagagttaatgccaaactttaacccttatcttaaccattcagagttaatgccaaaccttaacccttatcttgaccattcagagttaatgcctaaccttaacc

Function


NR:

description
PREDICTED: uncharacterized protein LOC106575560

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1712995 True 554 TUCP 0.36 1 83982341 83982894
Loading

Neighbor


gene id symbol gene type direction distance location
ccdc66 LOC106566088 coding downstream 130284 83837851 ~ 83860046 (-)
si:dkey-261l7.2 LOC106566092 coding downstream 353277 83608842 ~ 83629064 (-)
LOC110494733 LOC106566096 coding downstream 428621 83532512 ~ 83553720 (-)
LOC110494731 LOC106566009 coding downstream 573626 83397640 ~ 83408715 (-)
LOC110494730 LOC106566007 coding downstream 587459 83388660 ~ 83394882 (-)
LOC110494754 LOC106566081 coding upstream 49471 84032365 ~ 84046538 (-)
LOC110493281 LOC106593201 coding upstream 707891 84690785 ~ 84713397 (-)
LOC110494760 ca119 coding upstream 743616 84724945 ~ 84730729 (-)
slc32a1 LOC106566112 coding upstream 899094 84881988 ~ 84887491 (-)
LOC110494769 LOC106566115 coding upstream 967626 84950520 ~ 84995003 (-)
G1498421 NA non-coding downstream 23909 83958165 ~ 83958432 (-)
G1498419 NA non-coding downstream 25505 83956550 ~ 83956836 (-)
G1498415 NA non-coding downstream 28914 83953212 ~ 83953427 (-)
G1498407 NA non-coding downstream 38030 83944094 ~ 83944311 (-)
G1498404 NA non-coding downstream 43968 83938064 ~ 83938373 (-)
G1498463 NA non-coding upstream 14482 83997376 ~ 83997621 (-)
G1498470 NA non-coding upstream 20511 84003405 ~ 84003634 (-)
G1498541 NA non-coding upstream 84224 84067118 ~ 84067470 (-)
G1498543 NA non-coding upstream 84988 84067882 ~ 84068289 (-)
G1498547 NA non-coding upstream 86499 84069393 ~ 84069609 (-)
G1498077 NA other downstream 376588 83605243 ~ 83605753 (-)
G1496921 NA other downstream 1320703 82629246 ~ 82661638 (-)
G1496689 NA other downstream 1736354 82235128 ~ 82245987 (-)
G1496390 NA other downstream 1807489 82172469 ~ 82174852 (-)
G1495552 NA other downstream 2655228 81326685 ~ 81327113 (-)
G1498522 NA other upstream 68116 84051010 ~ 84057392 (-)
G1499671 NA other upstream 1238231 85221125 ~ 85223119 (-)
G1499684 NA other upstream 1303762 85251788 ~ 85288117 (-)
LOC110494779 ddit3 other upstream 2256824 86236554 ~ 86242991 (-)
G1500834 LOC106566150 other upstream 2466785 86449679 ~ 86450734 (-)

Expression


G1498442 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 4.
End of interactive chart.

G1498442 Expression in each Bioproject

Bar chart with 10 bars.
G1498442 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network