G1499681



Basic Information


Item Value
gene id G1499681
gene name NA
gene type non-coding
species rainbow trout (Oncorhynchus mykiss)
category of species economic fish

Chromosome Information


Item Value
chromosome id NC_048581.1
NCBI id CM023235.2
chromosome length 95212422
location 85216600 ~ 85217234 (-)
genome version USDA_OmykA_1.1_2020_rainbow_trout_Genome

Sequence


>TU1714516
cttctgacatagtaaaacacccttctgacatagtaaaacacccttctgacatagtaaaacacccttctaccatagtaaaacacccttctaccatagtaaaacacccttctacttctaccatagtaaaacacccttctaccatagtaaaacacccttctaccacagtaaaacacccttctgacatagtaaaacacccttctacttctaccatagtaaaacacccttctgccatagtaaaacacccttctacttctaccatagtaaaacacccttctgacatagtaaaacacccttctaccatagtaaaacacccttctacccttctaccatagtaaaacacccttctaccatagtaaaacacccttctacccttctaccatagtaaaacacccttcaaccatagtaaaacacccttctaccatagtaaaacacccttctaccatagtaaaacacccttctacccttctaccatagtaaaacacccttcaaccatagtaaaacacccttctaccatagtaaaacacccttctaccatagtaaaacacccttctaccatagtaaaacacccttctaccatagtaaaacacccttctaccatagtaaaacacccttctaccatagtacaacacccttct

Function


NR:

description
PREDICTED: uncharacterized protein LOC106933171

GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU1714516 True 635 lncRNA 0.39 1 85216600 85217234

Neighbor


gene id symbol gene type direction distance location
LOC118940503 NA coding downstream 11925 85190797 ~ 85204675 (-)
LOC110494769 LOC106566115 coding downstream 221597 84950520 ~ 84995003 (-)
slc32a1 LOC106566112 coding downstream 329109 84881988 ~ 84887491 (-)
LOC110494760 ca119 coding downstream 485871 84724945 ~ 84730729 (-)
LOC110493281 LOC106593201 coding downstream 503203 84690785 ~ 84713397 (-)
shmt2 shmt2 coding upstream 83072 85300306 ~ 85342666 (-)
LOC110487407 NA coding upstream 99111 85316345 ~ 85318853 (-)
LOC118940505 NA coding upstream 107919 85325153 ~ 85326712 (-)
LOC110494775 LOC106566119 coding upstream 127287 85344521 ~ 85425394 (-)
LOC110494776 LOC106566127 coding upstream 492967 85710201 ~ 85713130 (-)
G1499661 NA non-coding downstream 46868 85169174 ~ 85169732 (-)
G1499646 NA non-coding downstream 68838 85146887 ~ 85147762 (-)
G1499576 NA non-coding downstream 183341 85011336 ~ 85033259 (-)
G1499566 NA non-coding downstream 224357 84990448 ~ 84992243 (-)
G1499550 NA non-coding downstream 258726 84957485 ~ 84957874 (-)
G1499682 NA non-coding upstream 75 85217309 ~ 85217771 (-)
G1499672 NA non-coding upstream 6351 85223585 ~ 85224065 (-)
G1499669 NA non-coding upstream 8872 85226106 ~ 85227280 (-)
G1499673 NA non-coding upstream 11320 85228554 ~ 85229705 (-)
G1499667 LOC106566122 non-coding upstream 22646 85239880 ~ 85241797 (-)
G1498522 NA other downstream 1159208 84051010 ~ 84057392 (-)
G1498442 NA other downstream 1233706 83982341 ~ 83982894 (-)
G1498077 NA other downstream 1610847 83605243 ~ 83605753 (-)
G1496921 NA other downstream 2554962 82629246 ~ 82661638 (-)
G1496689 NA other downstream 2970613 82235128 ~ 82245987 (-)
G1499671 NA other upstream 3891 85221125 ~ 85223119 (-)
G1499684 NA other upstream 69422 85251788 ~ 85288117 (-)
LOC110494779 ddit3 other upstream 1022484 86236554 ~ 86242991 (-)
G1500834 LOC106566150 other upstream 1232445 86449679 ~ 86450734 (-)
LOC110493290 map3k12 other upstream 1580831 86798065 ~ 86880836 (-)

Expression


G1499681 Expression in all Baseline Samples

Bar chart with 20 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 15.
End of interactive chart.

G1499681 Expression in each Bioproject

Bar chart with 18 bars.
G1499681 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 60.
End of interactive chart.

Co-expression Network